View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_high_7 (Length: 318)
Name: NF0833_high_7
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0833_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 36926235 - 36926447
Alignment:
| Q |
1 |
actcggaacttcaattttggtggaaggaaataagggaagagggtcatggtgacaagaaagatgagccttggtggccaaagatgcatactctcaaagatct |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
36926235 |
actcggaacttcaatcttggtggaaggaaataagggaagagggtcatggtgacaagaaagatgagccttggtggccaaagatgcatactctcgaagagct |
36926334 |
T |
 |
| Q |
101 |
gattgaaacttgcactattattatatggattgcttcagctctccatgctgcagtcaactttggacagtatccatatggaggctatccaccgagtcgtcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36926335 |
gattgaaacttgcactattattatatggattgcttcagctctccatgctgcagtcaactttggacagtatccatatggaggctatccaccgagtcgtcct |
36926434 |
T |
 |
| Q |
201 |
tctatgagccgac |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36926435 |
tctatgagccgac |
36926447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 111 - 190
Target Start/End: Complemental strand, 49608461 - 49608382
Alignment:
| Q |
111 |
tgcactattattatatggattgcttcagctctccatgctgcagtcaactttggacagtatccatatggaggctatccacc |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| || |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49608461 |
tgcactattattatatggattgcttcaactctccatgttgttgtcaactttggacattatccatatggaggctatccacc |
49608382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 35 - 85
Target Start/End: Complemental strand, 49608508 - 49608458
Alignment:
| Q |
35 |
ggaagagggtcatggtgacaagaaagatgagccttggtggccaaagatgca |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49608508 |
ggaagaggatcatggtgacaagaaagatgagccttggtggccaaagatgca |
49608458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 36 - 181
Target Start/End: Complemental strand, 6262378 - 6262233
Alignment:
| Q |
36 |
gaagagggtcatggtgacaagaaagatgagccttggtggccaaagatgcatactctcaaagatctgattgaaacttgcactattattatatggattgctt |
135 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| |||||||| || ||||| |||| | |||| ||||| || ||||| |||||| ||||||| ||||| |
|
|
| T |
6262378 |
gaagtgggtcatggtgacaagaaagacgagccatggtggccgaaaatgcaaactcgcgaagagttgattcaagtttgcagtattatcatatggactgctt |
6262279 |
T |
 |
| Q |
136 |
cagctctccatgctgcagtcaactttggacagtatccatatggagg |
181 |
Q |
| |
|
||||||| ||||| || || || |||||||| ||||| |||||||| |
|
|
| T |
6262278 |
cagctcttcatgcagctgttaattttggacaatatccgtatggagg |
6262233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 40 - 181
Target Start/End: Complemental strand, 6456288 - 6456147
Alignment:
| Q |
40 |
agggtcatggtgacaagaaagatgagccttggtggccaaagatgcatactctcaaagatctgattgaaacttgcactattattatatggattgcttcagc |
139 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||| |||||||| ||| | ||| || || || ||||| | ||||| ||||||| ||||||||| |
|
|
| T |
6456288 |
agggtcatggtgacttgaaagacaagccatggtggcctaagatgcaaactgttggagacttggttcaatcttgctccattatcatatggactgcttcagc |
6456189 |
T |
 |
| Q |
140 |
tctccatgctgcagtcaactttggacagtatccatatggagg |
181 |
Q |
| |
|
||| ||||| ||||| ||||||||||||||||| |||||||| |
|
|
| T |
6456188 |
tcttcatgcagcagttaactttggacagtatccttatggagg |
6456147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 181
Target Start/End: Complemental strand, 6362174 - 6362116
Alignment:
| Q |
123 |
atatggattgcttcagctctccatgctgcagtcaactttggacagtatccatatggagg |
181 |
Q |
| |
|
||||||||||||||||| || ||||| ||||| || |||||||| ||||| |||||||| |
|
|
| T |
6362174 |
atatggattgcttcagcacttcatgcagcagttaattttggacaatatccgtatggagg |
6362116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 100 - 181
Target Start/End: Complemental strand, 6330864 - 6330783
Alignment:
| Q |
100 |
tgattgaaacttgcactattattatatggattgcttcagctctccatgctgcagtcaactttggacagtatccatatggagg |
181 |
Q |
| |
|
|||||||| |||||||||| | ||||||||||||||||| | ||||| || || || ||||| || |||||||||||||| |
|
|
| T |
6330864 |
tgattgaagcttgcactatcctcatatggattgcttcagcacatcatgcagctgttaattttggtcaatatccatatggagg |
6330783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 121 - 181
Target Start/End: Complemental strand, 6351291 - 6351231
Alignment:
| Q |
121 |
ttatatggattgcttcagctctccatgctgcagtcaactttggacagtatccatatggagg |
181 |
Q |
| |
|
||||||||||||||||||| || ||||| || || || || ||||| |||||||||||||| |
|
|
| T |
6351291 |
ttatatggattgcttcagcacttcatgcagctgttaatttcggacaatatccatatggagg |
6351231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 121 - 181
Target Start/End: Complemental strand, 6423208 - 6423148
Alignment:
| Q |
121 |
ttatatggattgcttcagctctccatgctgcagtcaactttggacagtatccatatggagg |
181 |
Q |
| |
|
||||||||||||||||||| || ||||| || || || |||||||| || ||||||||||| |
|
|
| T |
6423208 |
ttatatggattgcttcagcacttcatgcagctgttaattttggacaatacccatatggagg |
6423148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 172
Target Start/End: Complemental strand, 46709351 - 46709185
Alignment:
| Q |
6 |
gaacttcaattttggtggaaggaaataagggaagagggtcatggtgacaagaaagatgagccttggtggccaaagatgcatactctcaaagatctgattg |
105 |
Q |
| |
|
||||| |||| ||||||||||||| | | |||| ||||| || ||||||||| | ||||||||||||||||||||||| || | |||| ||| | |
|
|
| T |
46709351 |
gaactacaatcttggtggaaggaattgatacaagaaggtcacggcgacaagaaaaacgagccttggtggccaaagatgcaaacagtggaagagttgacgg |
46709252 |
T |
 |
| Q |
106 |
aaacttgcactattattatatggattgcttcagctctccatgctgcagtcaactttggacagtatcc |
172 |
Q |
| |
|
|||| ||||| || ||||||||||||||||||||||| ||||| || || ||||||||||| ||||| |
|
|
| T |
46709251 |
aaacatgcacaatcattatatggattgcttcagctctacatgcagctgtaaactttggacaatatcc |
46709185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 11 - 79
Target Start/End: Complemental strand, 44000277 - 44000209
Alignment:
| Q |
11 |
tcaattttggtggaaggaaataagggaagagggtcatggtgacaagaaagatgagccttggtggccaaa |
79 |
Q |
| |
|
||||| |||||||||||||||||| ||| | ||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
44000277 |
tcaatcttggtggaaggaaataagagaaaatggtcacggtgacaagaaatatgagccatggtggccaaa |
44000209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 170
Target Start/End: Complemental strand, 42692230 - 42692170
Alignment:
| Q |
110 |
ttgcactattattatatggattgcttcagctctccatgctgcagtcaactttggacagtat |
170 |
Q |
| |
|
|||||||| | | |||||||||||||||||||| ||||| || || || |||||||||||| |
|
|
| T |
42692230 |
ttgcactactgtcatatggattgcttcagctcttcatgcagctgttaattttggacagtat |
42692170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University