View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_high_8 (Length: 305)
Name: NF0833_high_8
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0833_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 47 - 123
Target Start/End: Original strand, 32361879 - 32361955
Alignment:
Q |
47 |
tgtgatgtgattacaaccattattgcaacagaaatttaaaattattttttcccttctttaaattagttttcttcaag |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32361879 |
tgtgatgtgattacaaccattattgcaacagaaatttaaaattattttttcccttctttaaattagttttcttcaag |
32361955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 32362059 - 32362113
Alignment:
Q |
222 |
cgacaatgacttgtcaatgaggttcaataatatgtctatattctaatgaacaatg |
276 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
32362059 |
cgacaatgacttgtcaatgaggttcaataatatgtctacattctaatgaacaatg |
32362113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 336 times since January 2019
Visitors: 6128