View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_high_9 (Length: 299)
Name: NF0833_high_9
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0833_high_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 78 - 299
Target Start/End: Complemental strand, 4224799 - 4224576
Alignment:
| Q |
78 |
gtaatccatcataaatcaatgtataaaaatcgtttgaaacactaactaaacttgagattgacccagaactagaagtagaaacttttgtacaaaattgaag |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4224799 |
gtaatccatcataaatcaatgtataaaaatcgtttgaaacactaactaaacttgagattgacctagaactagaagtagaaacttttgtacaaaattgaag |
4224700 |
T |
 |
| Q |
178 |
accat--tgctcaatcaatttgataagagacacacttccatctctaaatcattcaaaatgttcatcacatggttcacacaaggtctacatttccttggat |
275 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4224699 |
accatattgctcaatcaatttgataagagacacacttccatctctaaatcattcaaaatgttcatcacatggttcacacaaggtctacatttccttggat |
4224600 |
T |
 |
| Q |
276 |
taccaacacaagcagaagcaactt |
299 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4224599 |
taccaacacaagcagaagcaactt |
4224576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University