View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_low_16 (Length: 287)
Name: NF0833_low_16
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0833_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 107 - 258
Target Start/End: Original strand, 41676104 - 41676255
Alignment:
| Q |
107 |
tttgttgatcatagacattataggggacagtttgacacctatgttaaaaagagcagctttaaacgaaagtctctcatgcataatgcaccatataaggtga |
206 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
41676104 |
tttgtagatcatagacattataggggagagtttgacacctatgttaaaaagagcagctttaaacgaaagtctctcatgcataatggaccacatatggtga |
41676203 |
T |
 |
| Q |
207 |
acgtgactcaggatggtctcgatgttccatagtttggaccaaaccttcctat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41676204 |
acgtgactcaggatggtctcgatgttccatagtttggaccaaaccttcctat |
41676255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University