View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_low_7 (Length: 380)
Name: NF0833_low_7
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0833_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 24396472 - 24396707
Alignment:
| Q |
10 |
aagaatatgagagaatattttaggagtggtataacaaaggaagcatcttggagagaatcacaactaaaagggttgcgtcgtttcctagtggaaaaagaga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24396472 |
aagaatatgagagaatattttaggagtggtataacaaaggaagcatcttggagagaatcacaactaaaagggttgcgtcgtttcctagtggaaaaagaga |
24396571 |
T |
 |
| Q |
110 |
atgatatcttcatggccctcatgcaagatttagggaaacaccgtcttgaagcttttagagatgaggtatttctaaaccctacatatatataatttcttca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24396572 |
atgatatcttcatggccctcatgcaagatttagggaaacaccgtcttgaagcttttagagatgaggtatttctaaaccctacatatatataatttcttca |
24396671 |
T |
 |
| Q |
210 |
agttatgtagacatattttcgaatccaaggaatgca |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24396672 |
agttatgtagacatattttcgaatccaaggaatgca |
24396707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 23 - 87
Target Start/End: Original strand, 41842417 - 41842481
Alignment:
| Q |
23 |
aatattttaggagtggtataacaaaggaagcatcttggagagaatcacaactaaaagggttgcgt |
87 |
Q |
| |
|
|||||| | ||||||| | |||||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
41842417 |
aatattatgggagtggaaaaacaaaagaaacatcatggagagaatcacaactaaaagggttgcgt |
41842481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University