View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_low_8 (Length: 374)
Name: NF0833_low_8
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0833_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 280
Target Start/End: Complemental strand, 35251663 - 35251389
Alignment:
| Q |
9 |
caacaatataacagaagcttgatcttggctgatttaacggtggagatcgcaagtaaccgaaacctctgttcaatccgacggttcaaccaacagctccctc |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35251663 |
caacaaaataacagaagcttgatcttggctgatttaacggtggagatcgcaagtaaccgaaacctctgttcaatccgacggttcaaccaacagctccctc |
35251564 |
T |
 |
| Q |
109 |
tcatcaccgccgctaataacaagaaaatctaaatnnnnnnn---ccaaaaccggttcggttcagtaacgaaccaagaaaaccttcatttcgaaccggagc |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35251563 |
tcatcaccgccgctaataacaacaaaatctaaataaaaaaaaaaccaaaaccggttcggttcagtaacgaaccaagaaaaccttcatttcgaaccggagc |
35251464 |
T |
 |
| Q |
206 |
ttctgattagtttaagattttaacgtgtcttggatcatgaaaatggaagaggattcgtttgttttcgatggttaa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35251463 |
ttctgattagtttaagattttaacgtgtcttggatcatgaaaatggaagaggattcgtttgttttcgatggttaa |
35251389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University