View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0833_low_8 (Length: 374)

Name: NF0833_low_8
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0833_low_8
NF0833_low_8
[»] chr5 (1 HSPs)
chr5 (9-280)||(35251389-35251663)


Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 280
Target Start/End: Complemental strand, 35251663 - 35251389
Alignment:
9 caacaatataacagaagcttgatcttggctgatttaacggtggagatcgcaagtaaccgaaacctctgttcaatccgacggttcaaccaacagctccctc 108  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35251663 caacaaaataacagaagcttgatcttggctgatttaacggtggagatcgcaagtaaccgaaacctctgttcaatccgacggttcaaccaacagctccctc 35251564  T
109 tcatcaccgccgctaataacaagaaaatctaaatnnnnnnn---ccaaaaccggttcggttcagtaacgaaccaagaaaaccttcatttcgaaccggagc 205  Q
    |||||||||||||||||||||| |||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35251563 tcatcaccgccgctaataacaacaaaatctaaataaaaaaaaaaccaaaaccggttcggttcagtaacgaaccaagaaaaccttcatttcgaaccggagc 35251464  T
206 ttctgattagtttaagattttaacgtgtcttggatcatgaaaatggaagaggattcgtttgttttcgatggttaa 280  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35251463 ttctgattagtttaagattttaacgtgtcttggatcatgaaaatggaagaggattcgtttgttttcgatggttaa 35251389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 134 times since January 2019
Visitors: 6125