View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_low_9 (Length: 351)
Name: NF0833_low_9
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0833_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 90 - 339
Target Start/End: Original strand, 48664915 - 48665164
Alignment:
Q |
90 |
tcatcatttttattatttatttgaagtaaattttatagttgtcatgattgcagatatatgcagtctccatcacaataaggatagtggtaagataagttcc |
189 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48664915 |
tcatgatttttattatttatttgaagtaaattttatagttgtcatgattgcagatatatgcagtctccatcacaataaggatagtggtaagataagttcc |
48665014 |
T |
 |
Q |
190 |
tatcacctatttcagtgttatattttttatgctttgttttacataatcttggactttaaataagtccctccctctgtacttgcatataatttgtcaaact |
289 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48665015 |
tatcacctatttcagtgttatattttttatgctttgttttacataatcttggactttaaataagtccctccctctgtacttgcatataatttgtcaaact |
48665114 |
T |
 |
Q |
290 |
atatcctcttgcagcttggctttgttctcctagcatcaatctgggagtat |
339 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48665115 |
atatcctcttgcagcttggctttgttctcctagcatcaatctgggagtat |
48665164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1195 times since January 2019
Visitors: 6138