View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834-Insertion-3 (Length: 571)
Name: NF0834-Insertion-3
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834-Insertion-3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 515; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 515; E-Value: 0
Query Start/End: Original strand, 8 - 571
Target Start/End: Original strand, 36023575 - 36024137
Alignment:
| Q |
8 |
aggggagtagttaattcatggcagtagcagtcaagtaaatgtttccggagaagagtgtgctttatattgcagcttaatagggtcgatgtcatgcttatta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36023575 |
aggggagtagttaattcatggcagtagcagtcaagtaaatgtttccggagaagagtgtgctttatattgcagcttaatagggtcgatgtcatggttatta |
36023674 |
T |
 |
| Q |
108 |
attgtttgcacgttatttatgcgtagatcggaatccttattgctcaatgtatttcatattgccnnnnnnnnaaagcacttgtcggtgcttggggtggttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36023675 |
attgtttgcacgttatttatgcgtagatcggaatccttattgctcaatgtatttcatattgccttttttt-aaagcacttgtcggtgcttggggtggttt |
36023773 |
T |
 |
| Q |
208 |
tctgcactagaagttctaaatgacttgtttttagtctcaatctgtggttaataagcaaacaattgttttcttcctcgtgatttacgaagttcaatgtaat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36023774 |
tctgcactagaagttctaaatgacttgtttttagtctcaatctgtggttaataagcaaacaattgttttcttcctcgtgatttacgaagttcaatgtaat |
36023873 |
T |
 |
| Q |
308 |
tggttcatgttgtttctgaatgttttatgatatcagtatatgtagtgccggatatatttactatttcagcataaagctttgttattgtcttgccaaaacc |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36023874 |
tggttcatgttgtttctgaatgttttatgatatcagtatatgtagtgccagatatatttactatttcagcataaagctttgttattgtcttgccaaaacc |
36023973 |
T |
 |
| Q |
408 |
atcgtcacttctacagttgttattttagaaagtgtacactgttcaagcatcaatttcactctagcgatagttgttaatccattttgtaaggcaaccttac |
507 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
36023974 |
attgtcacttctacagttgttattttagaaagtgtacactgttcaagcatcaatttcactctaacgatagttgttaatccattttgtaaggcaaccttgc |
36024073 |
T |
 |
| Q |
508 |
ttattttttcaaccattctgcttgtgcttgtgcatatgtatggctctaatatgaggctacaacc |
571 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36024074 |
ttattttttcaaccattctgcttgtgcttgtgcatatgtatggctctaatatgaggctacaacc |
36024137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University