View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834-Insertion-5 (Length: 80)
Name: NF0834-Insertion-5
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0834-Insertion-5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 32480999 - 32481034
Alignment:
Q |
8 |
gtaaactagttaaagatgaattcattgataacaaca |
43 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
32480999 |
gtaaactagttaaagatgaattcattgataacaaca |
32481034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University