View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_high_20 (Length: 330)
Name: NF0834_high_20
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 98 - 252
Target Start/End: Complemental strand, 107005 - 106851
Alignment:
| Q |
98 |
agtgtttgtgttataaagatcaaaagagaagagaatgaattacttgggtcgcgagcggtggctttaacagtgtaaccacgatggagaaggtaacgaacga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
107005 |
agtgtttgtgttataaagatcaaaagagaagagaatgaattacttgggtcgcgaacggtggctttaacagtgtaaccacgatggagaaggtaacgaacga |
106906 |
T |
|
| Q |
198 |
gccatgaagctatgtaacctgaagctccagttacacacacaacgttgctgttcat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
106905 |
gccatgaagctatgtaacctgaagctccagttacacacacaacgttgctgttcat |
106851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 107141 - 107051
Alignment:
| Q |
12 |
taatcaaatcaaacatagggtcaaaacttatgaagcacggacgtagacgcagacacattaactttaaacaatgacttaattaattcagtgt |
102 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| || ||||| || ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
107141 |
taatcaaatcaaacatagggtcaaaacgtatgaagcacgaacatagacacatacacattaactttaaacaatgacttaattaattaagtgt |
107051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 138 - 240
Target Start/End: Complemental strand, 87595 - 87493
Alignment:
| Q |
138 |
tacttgggtcgcgagcggtggctttaacagtgtaaccacgatggagaaggtaacgaacgagccatgaagctatgtaacctgaagctccagttacacacac |
237 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| |||||||| ||||| | || |||||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
87595 |
tacttggatcgcgaacggtggctttaacagtgtagccacgatgaagaagcaatcggacgagccatgaagcgatgtaacctgaagcgccagtcacacacac |
87496 |
T |
|
| Q |
238 |
aac |
240 |
Q |
| |
|
||| |
|
|
| T |
87495 |
aac |
87493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3655 times since January 2019
Visitors: 6174