View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0834_high_23 (Length: 301)

Name: NF0834_high_23
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0834_high_23
NF0834_high_23
[»] chr6 (1 HSPs)
chr6 (23-301)||(22730232-22730517)


Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 23 - 301
Target Start/End: Complemental strand, 22730517 - 22730232
Alignment:
23 taattcttttaaaataattccatttatttgagtgccttgtttacgaaataacta---gtacatgagatttctaaacacgtgctatgcaattgaattttga 119  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||    
22730517 taattcttttaaaataattccatttatttgagtgccgtgtttacgaaataactactagtacatgagatttctaaacacgtgctatgcaattgaattttga 22730418  T
120 gct-----------ttcttaatttgcattgaagctccatggaccataatttataacccagatagcaggaccacatctacaacacttcactttcgaaaacg 208  Q
    |||           ||| |||||| |||| |||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22730417 gctaagtatgagctttcataattttcattcaagctccat-------aatttataacccagatagcaggaccacatctacaacacttcactttcgaaaacg 22730325  T
209 acaccacatttaattgctcatattcatgtccatgtgagatgaatgagaaactatatggtgtccaatcaaacatggagaatagaaacatttgaa 301  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22730324 acaccacatttaattgctcatattcatgtccatgtgagatgaatgagaaactatatggtgtccaatcaaacatggagaatagaaacatttgaa 22730232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2687 times since January 2019
Visitors: 6165