View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_high_26 (Length: 259)
Name: NF0834_high_26
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 18783027 - 18782816
Alignment:
| Q |
19 |
atgaaaaacatacataacctccttagttgagttatttgatcaaacacaagcaaatgtataacattaggggcctgtttggataaatgacttaacttgcagt |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18783027 |
atgaaaaacatacataacatccttagttgagttatttgatcaaacacaagcaaatgtataacattaggggcctgtttggataaatgacttaacttgcagc |
18782928 |
T |
 |
| Q |
119 |
ttatatcataagcacttatcatgattagtacttgtacatcggtcgtttctataacaaaggataaaataaacttgtattgttttccataggatataagcta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18782927 |
ttatatcataagcacttatcatgattagtacttgtatatcggtcgtttctataacaaaggataaaataaacttgtattgttttccataggatataagcta |
18782828 |
T |
 |
| Q |
219 |
ttttcttaaata |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
18782827 |
ttttcttaaata |
18782816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 147
Target Start/End: Original strand, 48064189 - 48064245
Alignment:
| Q |
91 |
tgtttggataaatgacttaacttgcagtttatatcataagcacttatcatgattagt |
147 |
Q |
| |
|
|||||||||||| |||||| |||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
48064189 |
tgtttggataaacaacttaatttgcagcttatagcataagcccttatcatgattagt |
48064245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 90 - 149
Target Start/End: Complemental strand, 31517928 - 31517869
Alignment:
| Q |
90 |
ctgtttggataaatgacttaacttgcagtttatatcataagcacttatcatgattagtac |
149 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||| |||||||| |||||||||| ||||| |
|
|
| T |
31517928 |
ctgtttggataaatagcttaatttgcagcttatagcataagcatttatcatgataagtac |
31517869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 131
Target Start/End: Complemental strand, 28039510 - 28039466
Alignment:
| Q |
87 |
ggcctgtttggataaatgacttaacttgcagtttatatcataagc |
131 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| ||||||| |
|
|
| T |
28039510 |
ggcctgtttggataaacaacttaatttgcagtttatagcataagc |
28039466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University