View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_high_31 (Length: 251)
Name: NF0834_high_31
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_high_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 31224682 - 31224922
Alignment:
| Q |
11 |
cagagaaatcttcgtagaagaaaacatcactctggtggcttttaacccacatgctgatgctaacagagtcatcagcatctcgctcatatgtagaacgacg |
110 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||| |||||| ||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
31224682 |
cagagaaatcttggtagaagaaaacattactctggcggctttcaacccacatgctgatactaacagaatcatcagcatctagctcatatgtagaacgacg |
31224781 |
T |
 |
| Q |
111 |
gatttccctctcttgtcgttgaacataacggtgagtcaaaaggtcatcacggttacatggaccaccttgtttctcaactgattcattgtgcctatgcata |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31224782 |
gatttccctctcttgtcgtcgaacataacggtgagtcaaaaggtcgtcgcggttacatggacccccttgtttctcaactgattcattgtgcctctgcata |
31224881 |
T |
 |
| Q |
211 |
atggtctctactgacactccgacatgtagaagagataaaac |
251 |
Q |
| |
|
|||||||| || |||||||| |||| |||||| |||||||| |
|
|
| T |
31224882 |
atggtctccaccgacactccaacatatagaagggataaaac |
31224922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University