View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_high_33 (Length: 242)
Name: NF0834_high_33
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0834_high_33 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 242
Target Start/End: Complemental strand, 44575303 - 44575068
Alignment:
Q |
7 |
aaaagcgtcgtgactcggctttgaaacacaattcgtttatttcgcctgtgagctttggtttgctcttgccgcagtttgcgctgtccggtttaaatgaagc |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44575303 |
aaaagcgtcgtgactcggctttgaaacacaattcgtttatttcgcctgtgagctttggtttgctcttgccgcagtttgcgctgtccggtttaaatgaagc |
44575204 |
T |
 |
Q |
107 |
ctttgctgctgttgctataatggaattctttacccttcaagtgccggagtctatgaggactgtttctggtgccatcttctttttgagcctgtccattgca |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44575203 |
ctttgctgctgttgctataatggaattctttacccttcaagtgccggagtctatgaggactgtttctggtgccatcttctttttgagcctgtccattgca |
44575104 |
T |
 |
Q |
207 |
aactacactggttccttaattgtcaacattgttcat |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
44575103 |
aactacactggttccttaattgtcaacattgttcat |
44575068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University