View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_high_33 (Length: 242)
Name: NF0834_high_33
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_high_33 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 242
Target Start/End: Complemental strand, 44575303 - 44575068
Alignment:
| Q |
7 |
aaaagcgtcgtgactcggctttgaaacacaattcgtttatttcgcctgtgagctttggtttgctcttgccgcagtttgcgctgtccggtttaaatgaagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575303 |
aaaagcgtcgtgactcggctttgaaacacaattcgtttatttcgcctgtgagctttggtttgctcttgccgcagtttgcgctgtccggtttaaatgaagc |
44575204 |
T |
|
| Q |
107 |
ctttgctgctgttgctataatggaattctttacccttcaagtgccggagtctatgaggactgtttctggtgccatcttctttttgagcctgtccattgca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575203 |
ctttgctgctgttgctataatggaattctttacccttcaagtgccggagtctatgaggactgtttctggtgccatcttctttttgagcctgtccattgca |
44575104 |
T |
|
| Q |
207 |
aactacactggttccttaattgtcaacattgttcat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575103 |
aactacactggttccttaattgtcaacattgttcat |
44575068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2318 times since January 2019
Visitors: 6161