View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_high_41 (Length: 231)
Name: NF0834_high_41
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0834_high_41 |
 |  |
|
[»] scaffold1113 (2 HSPs) |
 |  |  |
|
[»] scaffold0961 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 23 - 174
Target Start/End: Original strand, 32684079 - 32684230
Alignment:
Q |
23 |
cagagataggggaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgtagacgcatgaatgagccggatgct |
122 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32684079 |
cagagatagggaaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgtagacgcatgaatgagccggatgct |
32684178 |
T |
 |
Q |
123 |
gatttagcattcaaggcaagtttttctctaacaataattttgattctaagtt |
174 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32684179 |
gatttagcattcaaggcaagtttttctctaacaataattttgattctaagtt |
32684230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 136 - 174
Target Start/End: Original strand, 32692090 - 32692128
Alignment:
Q |
136 |
aggcaagtttttctctaacaataattttgattctaagtt |
174 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32692090 |
aggcaagtttttctctaacaataattttgattctaagtt |
32692128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 134 - 57
Alignment:
Q |
97 |
gtagacgcatgaatgagccggatgctgatttagcattcaaggcaagtttttctctaacaataattttgattctaagtt |
174 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
134 |
gtagacgcgtgaatgagccggatgctgatttagcattcgaggcaagtttttctctaacaataattttgattctaagtt |
57 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 168
Target Start/End: Complemental strand, 1904 - 1872
Alignment:
Q |
136 |
aggcaagtttttctctaacaataattttgattc |
168 |
Q |
|
|
|||||||||||||||||||||| |||||||||| |
|
|
T |
1904 |
aggcaagtttttctctaacaatgattttgattc |
1872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0961 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0961
Description:
Target: scaffold0961; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 168
Target Start/End: Original strand, 1713 - 1745
Alignment:
Q |
136 |
aggcaagtttttctctaacaataattttgattc |
168 |
Q |
|
|
|||||||||||||||||||||| |||||||||| |
|
|
T |
1713 |
aggcaagtttttctctaacaatgattttgattc |
1745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2862 times since January 2019
Visitors: 6167