View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_high_51 (Length: 214)
Name: NF0834_high_51
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0834_high_51 |
 |  |
|
[»] scaffold1113 (2 HSPs) |
 |  |  |
|
[»] scaffold0961 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 51 - 196
Target Start/End: Original strand, 32684079 - 32684224
Alignment:
Q |
51 |
cagagataggggaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgtagacgcatgaatgagccggatgct |
150 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32684079 |
cagagatagggaaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgtagacgcatgaatgagccggatgct |
32684178 |
T |
 |
Q |
151 |
gatttagcattcaaggcaagtttttctctaacaataattttgattc |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32684179 |
gatttagcattcaaggcaagtttttctctaacaataattttgattc |
32684224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 196
Target Start/End: Original strand, 32692090 - 32692122
Alignment:
Q |
164 |
aggcaagtttttctctaacaataattttgattc |
196 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
32692090 |
aggcaagtttttctctaacaataattttgattc |
32692122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 125 - 196
Target Start/End: Complemental strand, 134 - 63
Alignment:
Q |
125 |
gtagacgcatgaatgagccggatgctgatttagcattcaaggcaagtttttctctaacaataattttgattc |
196 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
134 |
gtagacgcgtgaatgagccggatgctgatttagcattcgaggcaagtttttctctaacaataattttgattc |
63 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 196
Target Start/End: Complemental strand, 1904 - 1872
Alignment:
Q |
164 |
aggcaagtttttctctaacaataattttgattc |
196 |
Q |
|
|
|||||||||||||||||||||| |||||||||| |
|
|
T |
1904 |
aggcaagtttttctctaacaatgattttgattc |
1872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0961 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0961
Description:
Target: scaffold0961; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 196
Target Start/End: Original strand, 1713 - 1745
Alignment:
Q |
164 |
aggcaagtttttctctaacaataattttgattc |
196 |
Q |
|
|
|||||||||||||||||||||| |||||||||| |
|
|
T |
1713 |
aggcaagtttttctctaacaatgattttgattc |
1745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3519 times since January 2019
Visitors: 6174