View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_high_62 (Length: 205)
Name: NF0834_high_62
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_high_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 42059401 - 42059322
Alignment:
| Q |
15 |
ttagattgatcattaagttcattggttaaaggaataaatttccacgacatcaaaattcattttgaactttatatctctgc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42059401 |
ttagattgatcattaagttcattggttaaaggaataaatttccacgacatcaaaattcattttgaactttatatctctgc |
42059322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3631 times since January 2019
Visitors: 6174