View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_high_63 (Length: 203)
Name: NF0834_high_63
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_high_63 |
 | |
|
| [»] scaffold1113 (2 HSPs) |
| | |
|
| [»] scaffold0961 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 31 - 182
Target Start/End: Original strand, 32684079 - 32684230
Alignment:
| Q |
31 |
cagagataggggaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgtagacgcatgaatgagccggatgct |
130 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684079 |
cagagatagggaaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgtagacgcatgaatgagccggatgct |
32684178 |
T |
|
| Q |
131 |
gatttagcattcaaggcaagtttttctctaacaataattttgattctaagtt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684179 |
gatttagcattcaaggcaagtttttctctaacaataattttgattctaagtt |
32684230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 144 - 182
Target Start/End: Original strand, 32692090 - 32692128
Alignment:
| Q |
144 |
aggcaagtttttctctaacaataattttgattctaagtt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32692090 |
aggcaagtttttctctaacaataattttgattctaagtt |
32692128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 105 - 182
Target Start/End: Complemental strand, 134 - 57
Alignment:
| Q |
105 |
gtagacgcatgaatgagccggatgctgatttagcattcaaggcaagtttttctctaacaataattttgattctaagtt |
182 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
134 |
gtagacgcgtgaatgagccggatgctgatttagcattcgaggcaagtttttctctaacaataattttgattctaagtt |
57 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 144 - 176
Target Start/End: Complemental strand, 1904 - 1872
Alignment:
| Q |
144 |
aggcaagtttttctctaacaataattttgattc |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
1904 |
aggcaagtttttctctaacaatgattttgattc |
1872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0961 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0961
Description:
Target: scaffold0961; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 144 - 176
Target Start/End: Original strand, 1713 - 1745
Alignment:
| Q |
144 |
aggcaagtttttctctaacaataattttgattc |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
1713 |
aggcaagtttttctctaacaatgattttgattc |
1745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3286 times since January 2019
Visitors: 6172