View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_10 (Length: 452)
Name: NF0834_low_10
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 30 - 439
Target Start/End: Complemental strand, 44575090 - 44574680
Alignment:
| Q |
30 |
ccttaattgtcaacattgttcatcaagcaacatcacataaagggaaaacaccttggttaggtggtcaagatttaaatcatactaggcttgattactatta |
129 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575090 |
ccttaattgtcaacattgttcataaagcaacatcacataaagggaaaacaccttggttaggtggtcaagatttaaatcatactaggcttgattactatta |
44574991 |
T |
 |
| Q |
130 |
ttatttaattgcttccattggagttttgaattttatctatttcaacttctttgcttgccattatttgataagtggcaaggaaattgagaaagctgaggtg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574990 |
ttatttaattgcttccattggagttttgaattttatctatttcaacttctttgcttgccattatttgataagtggcaaggaaattgagaaagctgaggtg |
44574891 |
T |
 |
| Q |
230 |
caaccaattgctagtgtgaagggagaatcagatgaacaagatgatgaggaaaaggttttggatagagtaggcactagataaaaggcaacttgatcatact |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44574890 |
caaccaattgctagtgtgaagggagaatcagatgaacaagatgatgaggaaaaggttttggatagagtaggcactagatgaaaggcaacttgatcatact |
44574791 |
T |
 |
| Q |
330 |
ctcatgctgctaaagtttaaatttcataaactctagttctattttagctattgttaga-tctttttccttagagaagcaccatgtagtttagttttggtc |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574790 |
ctcatgctgctaaagtttaaatttcataaactctagttctcttttagttattgttagattctttttccttagagaagcaccatgtagtttagttttggtc |
44574691 |
T |
 |
| Q |
429 |
tagttttatat |
439 |
Q |
| |
|
||||| ||||| |
|
|
| T |
44574690 |
tagttgtatat |
44574680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University