View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_20 (Length: 358)
Name: NF0834_low_20
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0834_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 54022241 - 54022025
Alignment:
Q |
1 |
aagatagccataggagctgctagaggtttgggtttcttacacacttcagaaaaatcagttatatatagagacttcaagtcttcaaacattttgcttgatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54022241 |
aagatagccataggagctgctagaggtttgggtttcttacacacttcagaaaaatcagttatatatagagacttcaagtcttcaaacattttgcttgatg |
54022142 |
T |
 |
Q |
101 |
gggtaagaatgtaataaagttcattttttgtatgtatgtgatgatttttgaataaaaggggaatcaattattgagacccaaagaatgttagttagtacat |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
54022141 |
gggtaagaatgtaataaagttcattttttgtatgtatgtgatgatttttgaataaaaggggaatcaactattgagacccaaagaatgt----tagtacat |
54022046 |
T |
 |
Q |
201 |
gttctgttacaactttattga |
221 |
Q |
|
|
|||||||||||||||| |||| |
|
|
T |
54022045 |
gttctgttacaacttttttga |
54022025 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 242 - 349
Target Start/End: Complemental strand, 54022031 - 54021924
Alignment:
Q |
242 |
tttttgaataacaggatttcaatgcaaagttgtctgactttggattggcaaagcttggacctgtcaacggtagatcacatgtaaccacacggatcatggg |
341 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54022031 |
tttttgaataacaggatttcaatgcaaagttgtctgactttggattggcaaagcttggacctgtcaacggtagatcacatgtaaccacacggatcatggg |
54021932 |
T |
 |
Q |
342 |
tacctatg |
349 |
Q |
|
|
|||||||| |
|
|
T |
54021931 |
tacctatg |
54021924 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University