View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_33 (Length: 318)
Name: NF0834_low_33
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0834_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 75 - 266
Target Start/End: Complemental strand, 42335204 - 42335009
Alignment:
Q |
75 |
ggagcagagaccacgaagagctccaagtggctaggaggtttagctttgagtgggattattgtcatcttgttcttctaga-----gatttgttgaattaat |
169 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
42335204 |
ggagcagacaccacgaagagctccaagtggctaggaggtttagctttgagtgggattattgtcatcttgttcttctagatatgagatttgttgaattaat |
42335105 |
T |
 |
Q |
170 |
gtttgtagaagaagatgaaatgttcaaacttaatggttgttttataaatcgttgcttttaattatcatattttccgtattataataactttccatcc |
266 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
42335104 |
gtttgtagaagaagatgaaatgttcaaacttaatggttgttttataaatcgttgcttttaattatcata-tttccgtattataataactttccatcc |
42335009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University