View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_35 (Length: 301)
Name: NF0834_low_35
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_low_35 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 23 - 301
Target Start/End: Complemental strand, 22730517 - 22730232
Alignment:
| Q |
23 |
taattcttttaaaataattccatttatttgagtgccttgtttacgaaataacta---gtacatgagatttctaaacacgtgctatgcaattgaattttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22730517 |
taattcttttaaaataattccatttatttgagtgccgtgtttacgaaataactactagtacatgagatttctaaacacgtgctatgcaattgaattttga |
22730418 |
T |
 |
| Q |
120 |
gct-----------ttcttaatttgcattgaagctccatggaccataatttataacccagatagcaggaccacatctacaacacttcactttcgaaaacg |
208 |
Q |
| |
|
||| ||| |||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22730417 |
gctaagtatgagctttcataattttcattcaagctccat-------aatttataacccagatagcaggaccacatctacaacacttcactttcgaaaacg |
22730325 |
T |
 |
| Q |
209 |
acaccacatttaattgctcatattcatgtccatgtgagatgaatgagaaactatatggtgtccaatcaaacatggagaatagaaacatttgaa |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22730324 |
acaccacatttaattgctcatattcatgtccatgtgagatgaatgagaaactatatggtgtccaatcaaacatggagaatagaaacatttgaa |
22730232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University