View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_38 (Length: 293)
Name: NF0834_low_38
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 63 - 114
Target Start/End: Original strand, 32577989 - 32578040
Alignment:
| Q |
63 |
caatatcaatatgtttagcacttacaaaacaaagattgcgacaaaattataa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32577989 |
caatatcaatatgtttagcacttacaaaacaaagattaagacaaaattataa |
32578040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 138 - 201
Target Start/End: Original strand, 32578064 - 32578127
Alignment:
| Q |
138 |
cttattgaattttctcaaacttattatcgtgtttggtatttgnnnnnnngtatatagtagtatg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32578064 |
cttattgaattttctcaaacttattatcgtgtttggtatttgtttttttgtatatagtagtatg |
32578127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University