View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_42 (Length: 256)
Name: NF0834_low_42
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_low_42 |
 |  |
|
| [»] chr3 (69 HSPs) |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (4 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 69)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 256
Target Start/End: Original strand, 33235545 - 33235793
Alignment:
| Q |
7 |
gtgagatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcg |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| | || |
|
|
| T |
33235545 |
gtgacatgaaaggtcacaagttcaaatcgtgtaaagagcctcttgtgtaaaaaaacagggtaagactgtgtacaatacactaaatggtgggacccct-cg |
33235643 |
T |
 |
| Q |
106 |
cagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgtttttagttcatttattggaaattaatttgaaatttgaacaggagctaagaa |
205 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33235644 |
cagaccttacgtatgcggaagctttagtgcaccaggttgcccttattgtttttagttcatttattggaaattaa-ttgaaatttgaacaggagctaagaa |
33235742 |
T |
 |
| Q |
206 |
agtggacgtggacttgaagcagcagaaagtaacagtgagtggatatgttga |
256 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33235743 |
agtggatgtggacttgaagcagcagaaagtaacggtgagtggatatgttga |
33235793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 12914171 - 12914036
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||||||||||||||||||||||| | ||||||||||||| |||||||| ||||| ||| ||| || | |
|
|
| T |
12914171 |
gaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacaccaaatggtgagaccccttcccagaccct |
12914072 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||||||||||||| | |||||| |||||||||| |
|
|
| T |
12914071 |
gcatatgcgggagcttcaatgcaccgggttgccctt |
12914036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 26 - 149
Target Start/End: Complemental strand, 40272936 - 40272813
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || || ||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||||||| |
|
|
| T |
40272936 |
gttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggga |
40272837 |
T |
 |
| Q |
126 |
gctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
40272836 |
gctttagtgcaccgggttgccctt |
40272813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 26 - 138
Target Start/End: Complemental strand, 6411945 - 6411834
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || |||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||| |||||||| ||| ||| |||| ||||||||||| |
|
|
| T |
6411945 |
gttcaagtcttgtaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcggga |
6411847 |
T |
 |
| Q |
126 |
gctttagtgcacc |
138 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6411846 |
gctttagtgcacc |
6411834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 26 - 150
Target Start/End: Original strand, 22609799 - 22609922
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || || |||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| ||| | | |||| ||||||||||| |
|
|
| T |
22609799 |
gttcaagtcttggaaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcggga |
22609897 |
T |
 |
| Q |
126 |
gctttagtgcaccaggttgccctta |
150 |
Q |
| |
|
|||| |||||||| ||||||||||| |
|
|
| T |
22609898 |
gcttcagtgcaccgggttgccctta |
22609922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 13628929 - 13628791
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||| |||||||||||| ||||||||||||||| | ||||||||||||| ||| | | | |
|
|
| T |
13628929 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggac |
13628830 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
13628829 |
cctgcgtatgcgggagctttagtgcaccgggttgccctt |
13628791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 39203536 - 39203670
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || | |||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||| ||| | | ||| |
|
|
| T |
39203536 |
tgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaa--cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggacct |
39203633 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||| |||||||||| |
|
|
| T |
39203634 |
tgcatatgcgggagctttagtgcaccgggttgccctt |
39203670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 26869727 - 26869862
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || || ||||||||||| |||||||| |||||||||| ||||||||||||||| |||||||||||||| || | | || |
|
|
| T |
26869727 |
tgaaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccccttgccggacca |
26869825 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
26869826 |
tgcgtatgcgggagctttggtgcaccgggttgccctt |
26869862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 39 - 150
Target Start/End: Complemental strand, 31904968 - 31904856
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggga-ccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||||| || |||||||||||||||| ||||||||||||||||| ||||||||||| ||| ||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
31904968 |
aaacagcctattatgtaaaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagctttagtgcac |
31904869 |
T |
 |
| Q |
138 |
caggttgccctta |
150 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
31904868 |
caggctgccctta |
31904856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 13 - 148
Target Start/End: Original strand, 26573147 - 26573282
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||| |||||||||||||||||||| ||||||||||||||| || ||||||||||| || | | || |
|
|
| T |
26573147 |
tgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccatcccggaccc |
26573246 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccct |
148 |
Q |
| |
|
| |||||||| |||||||||||||||||| |||||| |
|
|
| T |
26573247 |
tgcgtatgcgtgagctttagtgcaccaggctgccct |
26573282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 54484736 - 54484847
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
|||||||||||||||||||||| || |||||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||||||||||||||||||| |
|
|
| T |
54484736 |
aaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
54484835 |
T |
 |
| Q |
138 |
caggttgccctt |
149 |
Q |
| |
|
| |||||||||| |
|
|
| T |
54484836 |
cgggttgccctt |
54484847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 26 - 149
Target Start/End: Original strand, 14986990 - 14987115
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgg |
123 |
Q |
| |
|
|||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | |||| | ||||||| |
|
|
| T |
14986990 |
gttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgg |
14987089 |
T |
 |
| Q |
124 |
gagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||| |||| ||||| |
|
|
| T |
14987090 |
gagctttagtgcaccgggtttccctt |
14987115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 34420781 - 34420656
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||||||||||||| |||||||| ||||| | |||||||||||||| ||| | | || |
|
|
| T |
34420781 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaatggtgggaccccttcccggacc |
34420682 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
|| |||||| |||||||||||||||| |
|
|
| T |
34420681 |
ttgcgtatgtgggagctttagtgcac |
34420656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 26 - 149
Target Start/End: Complemental strand, 10795549 - 10795424
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcccttacgtatgcgg |
123 |
Q |
| |
|
|||||| || || |||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| ||| | || | ||||||||| |
|
|
| T |
10795549 |
gttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgg |
10795450 |
T |
 |
| Q |
124 |
gagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
10795449 |
gagcttcagtgcaccaggttgccctt |
10795424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 149
Target Start/End: Complemental strand, 46421172 - 46421035
Alignment:
| Q |
15 |
aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||| |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | || |
|
|
| T |
46421172 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
46421073 |
T |
 |
| Q |
113 |
tacgtatgcgggagcttt-agtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||| |||||||| | |||||||| |
|
|
| T |
46421072 |
tgcgtatgcgggagctttaagtgcaccggtttgccctt |
46421035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 516429 - 516568
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata---cactaaatggtgggaccctttcgcagc |
109 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||||||||||||| ||||| |||||| || |||||| ||||||| ||| | | |
|
|
| T |
516429 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcgggaccccttccccga |
516528 |
T |
 |
| Q |
110 |
ccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
516529 |
ccctgcgtatgcgggagctttagtgcaccgggttgccctt |
516568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 1217110 - 1217244
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||| ||||||| ||| | | || |
|
|
| T |
1217110 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggcgggaccccttcccggaccc |
1217207 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
1217208 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
1217244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 149
Target Start/End: Complemental strand, 29366857 - 29366721
Alignment:
| Q |
15 |
aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||| |||||| || || |||||||||||||| |||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | || |
|
|
| T |
29366857 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
29366758 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
29366757 |
tgcgtatgtgggagctttagtgcactgggttgccctt |
29366721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 45786327 - 45786215
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | || |||| |||||||||||||| |
|
|
| T |
45786327 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca |
45786228 |
T |
 |
| Q |
137 |
ccaggttgccctt |
149 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
45786227 |
ccgggttgccctt |
45786215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 53996703 - 53996566
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
||||||||||| |||||| ||||| ||||| ||||||||||||||||||||||||| |||| ||||||||| | |||||||||||||| ||| | | | |
|
|
| T |
53996703 |
tgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaatggtgggaccccttccctgaca |
53996604 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||| ||||||||||||||||| || ||||||| |
|
|
| T |
53996603 |
ctgcgtatgtgggagctttagtgcaccgggctgccctt |
53996566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 26 - 130
Target Start/End: Original strand, 55401209 - 55401314
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcggg |
124 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||| |||||||||||| |||||| | |||||||||||||| ||| | | |||| |||||||||| |
|
|
| T |
55401209 |
gttcaagtcctgtaaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcggg |
55401308 |
T |
 |
| Q |
125 |
agcttt |
130 |
Q |
| |
|
|||||| |
|
|
| T |
55401309 |
agcttt |
55401314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 39 - 146
Target Start/End: Original strand, 7943036 - 7943143
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggga-ccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||| || | ||||||||||||||||||||||| |
|
|
| T |
7943036 |
aaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgggatccctttc-cagaccatgcgtatgcgggagctttagtgcac |
7943134 |
T |
 |
| Q |
138 |
caggttgcc |
146 |
Q |
| |
|
||||||| |
|
|
| T |
7943135 |
tgggttgcc |
7943143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 13730738 - 13730603
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||||||||||||| ||| ||||||||||| | ||||||||||||| ||| | | || |
|
|
| T |
13730738 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggacccc |
13730639 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||| |
|
|
| T |
13730638 |
gcatatgcgggagctttagtgcaccgggttgccctt |
13730603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 138
Target Start/End: Complemental strand, 45948972 - 45948850
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||||| |||||||||||||||| |||||||| |||| |||||||||| || ||||||||||| ||| | | || | | |
|
|
| T |
45948972 |
aaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattggtgggaccccttctcggaccctgc |
45948873 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45948872 |
gtatgcgggagctttagtgcacc |
45948850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 54374483 - 54374349
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
|||||||||||| |||||| || || ||||| |||||||||||||||| |||||||| ||||||||||| || | |||||||||||||| ||| | | || |
|
|
| T |
54374483 |
tgaaaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggacc |
54374384 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgcc |
146 |
Q |
| |
|
| | ||||||||||||||||| ||||||| |||| |
|
|
| T |
54374383 |
ctgcatatgcgggagctttagttcaccaggctgcc |
54374349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 49013586 - 49013474
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | || | || ||||||||||||||||| |
|
|
| T |
49013586 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgca |
49013487 |
T |
 |
| Q |
137 |
ccaggttgccctt |
149 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
49013486 |
ccgggttgccctt |
49013474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 152
Target Start/End: Complemental strand, 22123052 - 22122915
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||| | |||||| || || |||||| ||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
22123052 |
tgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
22122955 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgcccttatt |
152 |
Q |
| |
|
| | |||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
22122954 |
tgcatatgcgagagctctagtgcaccgggttgcccttatt |
22122915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 149
Target Start/End: Original strand, 31592882 - 31593003
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||| | ||| | | || | | ||||||||| |
|
|
| T |
31592882 |
gttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcggga |
31592979 |
T |
 |
| Q |
126 |
gctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||| ||||||||| |||||||||| |
|
|
| T |
31592980 |
gctctagtgcaccgggttgccctt |
31593003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 148
Target Start/End: Complemental strand, 8247826 - 8247688
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||| | ||| | | | |
|
|
| T |
8247826 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggac |
8247727 |
T |
 |
| Q |
111 |
cttacgtatgcgggagcttt-agtgcaccaggttgccct |
148 |
Q |
| |
|
| | |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
8247726 |
cctgcgtatgcgggagctttaagtgcactgggttgccct |
8247688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 16 - 101
Target Start/End: Complemental strand, 4495798 - 4495713
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccct |
101 |
Q |
| |
|
|||||||| |||||| || || ||| ||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
4495798 |
aaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccct |
4495713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 42 - 131
Target Start/End: Original strand, 9276313 - 9276401
Alignment:
| Q |
42 |
cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttta |
131 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||| | | || | ||||||||||| ||||| |
|
|
| T |
9276313 |
cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttta |
9276401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 42 - 149
Target Start/End: Original strand, 15797271 - 15797376
Alignment:
| Q |
42 |
cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccagg |
141 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||| ||||||| ||||||||| || |
|
|
| T |
15797271 |
cagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccggg |
15797368 |
T |
 |
| Q |
142 |
ttgccctt |
149 |
Q |
| |
|
|||||||| |
|
|
| T |
15797369 |
ttgccctt |
15797376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 39 - 150
Target Start/End: Original strand, 31672739 - 31672851
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccct-ttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||||| || ||||||||||| || |||| |||||||||||||| |||||||||||| || ||| || ||||||| ||||||||||||||||||| |
|
|
| T |
31672739 |
aaacagcctattatgtaaaaaacaaggcaagagtgcgtacaatacaccaaatggtgggactctcttcccatatcttacgtgtgcgggagctttagtgcac |
31672838 |
T |
 |
| Q |
138 |
caggttgccctta |
150 |
Q |
| |
|
|||| || ||||| |
|
|
| T |
31672839 |
caggctgtcctta |
31672851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 39 - 100
Target Start/End: Original strand, 47624088 - 47624148
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
47624088 |
aaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccc |
47624148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 101
Target Start/End: Complemental strand, 54032693 - 54032608
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccct |
101 |
Q |
| |
|
|||||||| |||||| || || ||||| ||||||||||||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
54032693 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtgggaccct |
54032608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 51 - 148
Target Start/End: Complemental strand, 353450 - 353351
Alignment:
| Q |
51 |
gtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccct |
148 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | || | |||||||||||||||||||||| ||||||||| |
|
|
| T |
353450 |
gtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 57 - 149
Target Start/End: Complemental strand, 34771457 - 34771365
Alignment:
| Q |
57 |
aaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| || ||||||| |
|
|
| T |
34771457 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgccctt |
34771365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 43 - 138
Target Start/End: Original strand, 19731052 - 19731147
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||| | ||||||||||||||| ||| | | |||||| |||||||||||||||| |
|
|
| T |
19731052 |
agcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactctgtgtatgcaggagctttagtgcacc |
19731147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 25517282 - 25517171
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||| |||||||||||||||| || | || | ||||||||||||||| |||||||||||||| ||| | | | | ||||||| ||||||||||||||| |
|
|
| T |
25517282 |
aaacatcctcttgtgtaaaaaaacaagatatggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcac |
25517183 |
T |
 |
| Q |
138 |
caggttgccctt |
149 |
Q |
| |
|
| |||||||||| |
|
|
| T |
25517182 |
cgggttgccctt |
25517171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 16735487 - 16735596
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||||| |||||||||||||| ||| | | | | ||||||||| ||||| ||||||| |
|
|
| T |
16735487 |
aaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcact |
16735585 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
16735586 |
gggttgccctt |
16735596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 75 - 149
Target Start/End: Original strand, 24578007 - 24578081
Alignment:
| Q |
75 |
gtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||| || ||| ||||||||| || ||||||||| |||||||||| |
|
|
| T |
24578007 |
gtacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgccctt |
24578081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 25944489 - 25944626
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa-tggtgggaccctttcgcagccc |
111 |
Q |
| |
|
|||||||||| |||||| || || |||| |||||| ||||||||||| ||| ||| ||| ||||||||||| ||| ||||||||||| ||| | | || |
|
|
| T |
25944489 |
tgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaaaatggtgggaccccttccctgacc |
25944588 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
25944589 |
ctgcgtatgtgggagctttagcgcaccaggctgccctt |
25944626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 25 - 136
Target Start/End: Complemental strand, 43114995 - 43114882
Alignment:
| Q |
25 |
agttcaaatcgtgtaaacagcctcttgtgtaa-aaaacagggtaa-gactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcg |
122 |
Q |
| |
|
||||||| || || |||||||||||||||||| |||||||||||| | || | |||||||||| |||||||||||||||| | ||| | |||||||| |
|
|
| T |
43114995 |
agttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtgggacccttcctggacccctgcgtatgcg |
43114896 |
T |
 |
| Q |
123 |
ggagctttagtgca |
136 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43114895 |
ggagctttagtgca |
43114882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 45620966 - 45620881
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtggga |
97 |
Q |
| |
|
||||||||||| |||||| | || |||||||||||||||||||||| ||||||||| ||||||||||||||| || |||||||| |
|
|
| T |
45620966 |
tgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaattggtggga |
45620881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 65 - 149
Target Start/End: Complemental strand, 52926304 - 52926220
Alignment:
| Q |
65 |
gtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| | ||| | | || | |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
52926304 |
gtaaggctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt |
52926220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 5173857 - 5173720
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa--tggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || ||||| ||||||||||||||| || ||||| ||| | |||||||| ||| ||||||| ||| ||| | | | |
|
|
| T |
5173857 |
tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaa-caaagtaaggttgcatgcaatacaccaaaaatggtggggccccttcccggac |
5173759 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
5173758 |
cttgcgtatgcgggagctttagtgcaccgggttgccctt |
5173720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 13 - 133
Target Start/End: Original strand, 9607223 - 9607345
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||| ||||||||||||||||| ||||||| ||||||| | |||| |||||||| ||| ||| | |
|
|
| T |
9607223 |
tgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaataatgttgggaccccttcccagac |
9607322 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagt |
133 |
Q |
| |
|
| | ||||||||||||||||| |
|
|
| T |
9607323 |
cccgcatatgcgggagctttagt |
9607345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 138
Target Start/End: Original strand, 19751628 - 19751723
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||| || |||||| |||||||||||||| | ||||||||||||||| ||| | || |||||| ||||||||||||||| |
|
|
| T |
19751628 |
agcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactttgtgtatgcatgagctttagtgcacc |
19751723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 45139615 - 45139479
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| | || ||||| |||||||||||||| |||||||||| |||| |||||||||| |||||||||||||| ||| ||| | |
|
|
| T |
45139615 |
tgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccagac |
45139516 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||||||||| |||| ||||||| || ||||||| |
|
|
| T |
45139515 |
c-tgcgtatgcgggaacttt-gtgcaccgggctgccctt |
45139479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 100
Target Start/End: Complemental strand, 52428585 - 52428527
Alignment:
| Q |
42 |
cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||| |||| |||| |||| |
|
|
| T |
52428585 |
cagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccc |
52428527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 65
Target Start/End: Original strand, 35417940 - 35417988
Alignment:
| Q |
17 |
aggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg |
65 |
Q |
| |
|
||||||| |||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
35417940 |
aggtcacgagttcaaatcctggaaacagcctcttgtgtaaaaaacaggg |
35417988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 43 - 138
Target Start/End: Complemental strand, 44403663 - 44403567
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatac-actaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||| ||| |||||| ||||| | ||||| || |||||||||||||| ||| | | || ||||||||| | |||||||||||||| |
|
|
| T |
44403663 |
agcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcacc |
44403567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 30928284 - 30928197
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||||||| |||||| || ||| ||||||| || ||| ||||||| |
|
|
| T |
30928284 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcgggaccc |
30928197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 150
Target Start/End: Complemental strand, 31922878 - 31922839
Alignment:
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctta |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31922878 |
cttacgtatgcgggagctttagtgcaccaggctgccctta |
31922839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 92
Target Start/End: Complemental strand, 7697020 - 7696945
Alignment:
| Q |
15 |
aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatgg |
92 |
Q |
| |
|
||||||||| |||||| || || |||||| ||||||||||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
7697020 |
aaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatgg |
7696945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 75
Target Start/End: Original strand, 12525427 - 12525489
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcg |
75 |
Q |
| |
|
|||||||||||| |||| | || || ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
12525427 |
tgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggtaaggctgcg |
12525489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 75 - 149
Target Start/End: Original strand, 24577917 - 24577991
Alignment:
| Q |
75 |
gtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| || | | ||| |||||||| ||||||||| | |||||||| |
|
|
| T |
24577917 |
gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgccctt |
24577991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 90
Target Start/End: Original strand, 21875046 - 21875111
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgt-aaaaaacagggtaagactgcgtacaatacactaaat |
90 |
Q |
| |
|
|||||||| || ||||| |||||||||| |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
21875046 |
gttcaaattctggaaacaacctcttgtgttaaaaaagagggtaaggctgcgtacaatacactaaat |
21875111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 77
Target Start/End: Complemental strand, 10870088 - 10870025
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgta |
77 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10870088 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaaggctgcgta |
10870025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 100
Target Start/End: Original strand, 33926103 - 33926190
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta-aatggtgggaccc |
100 |
Q |
| |
|
|||||||||| |||||| || || ||| |||||||||||||||| |||||||||| ||| ||||||||||| | ||||||||||||| |
|
|
| T |
33926103 |
tgaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaa-acagggtaaggctgtgtacaatacaccataatggtgggaccc |
33926190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 45 - 84
Target Start/End: Original strand, 39212042 - 39212081
Alignment:
| Q |
45 |
cctcttgtgtaaaaaacagggtaagactgcgtacaataca |
84 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
39212042 |
cctcttgtgtaaataacaaggtaagactgcgtacaataca |
39212081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 115 - 158
Target Start/End: Original strand, 47624221 - 47624264
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgcccttattgttttt |
158 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
47624221 |
cgtatgcgggagctttagtgcaccgggttgcccttttttttttt |
47624264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Complemental strand, 4495711 - 4495677
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
4495711 |
cgtatgcgggagctttagtgcaccgggttgccctt |
4495677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Complemental strand, 10484651 - 10484617
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
10484651 |
cgtatgcgggagctttagtgcaccgggttgccctt |
10484617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Original strand, 40390363 - 40390397
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
40390363 |
cgtatgcgggagctttagtgcaccgggttgccctt |
40390397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Complemental strand, 54032606 - 54032572
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
54032606 |
cgtatgcgggagctttagtgcaccgggttgccctt |
54032572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 99
Target Start/End: Complemental strand, 8410966 - 8410918
Alignment:
| Q |
51 |
gtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacc |
99 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| || |||||||||| |
|
|
| T |
8410966 |
gtgtaaaaaacagggtaaggctgctcacaatacaccaactggtgggacc |
8410918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 149
Target Start/End: Complemental strand, 24851334 - 24851302
Alignment:
| Q |
117 |
tatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
24851334 |
tatgcgggagctttagtgcaccgggttgccctt |
24851302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 99
Target Start/End: Original strand, 52952532 - 52952592
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacc |
99 |
Q |
| |
|
||||| |||||| ||||||||| | | |||||||| ||||||||||| |||| |||||||| |
|
|
| T |
52952532 |
aaacaacctcttatgtaaaaaatatgataagactgtgtacaatacaccaaatagtgggacc |
52952592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 70)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 46248090 - 46247954
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||| ||||| |||||| || || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
46248090 |
tgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccggaccc |
46247991 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
46247990 |
tgcgtatgcgggagctttagtgtaccgggttgccctt |
46247954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 136
Target Start/End: Complemental strand, 23768454 - 23768334
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
||||||||| |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| | ||| ||| || | | |
|
|
| T |
23768454 |
aaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggacaccttcccagaccctgc |
23768355 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgca |
136 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23768354 |
gtatgcgggagctttagtgca |
23768334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 34725233 - 34725099
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||| | | || |
|
|
| T |
34725233 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacactaaatggtgggaccccttcccggaccc |
34725136 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
34725135 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
34725099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 18944664 - 18944803
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||||||||| |||||| | || ||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | | |
|
|
| T |
18944664 |
tgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggac |
18944763 |
T |
 |
| Q |
111 |
cttacgtatgcgggagc-tttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
18944764 |
cctgcgtatgcgggagcttttagtgcaccgggttgccctt |
18944803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 32632693 - 32632558
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| || || |
|
|
| T |
32632693 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccaaaccc |
32632595 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
32632594 |
tgcatatgcgggagcttgagtgcaccaggtttccctt |
32632558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 10668246 - 10668384
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||||||| |||||| |||||||||||||| | ||||||||||||| ||| | | | |
|
|
| T |
10668246 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtc |
10668345 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
10668346 |
cctgcgtatgcgggagctttagtgcaccgggttgccctt |
10668384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 35005144 - 35005282
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||| ||| | | | |
|
|
| T |
35005144 |
tgaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggac |
35005243 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
35005244 |
cctgcgtatgcgggcgctttagtgcaccgggttgccctt |
35005282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 53 - 149
Target Start/End: Original strand, 4349699 - 4349795
Alignment:
| Q |
53 |
gtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
4349699 |
gtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
4349795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 14617059 - 14617195
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| ||||||| || || ||||||||||||||||||| |||| |||||| |||||||||||||| ||||||||||| || ||| | | || |
|
|
| T |
14617059 |
tgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaaatggtgggatcccttcccggaccc |
14617158 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||| |||| ||||| |
|
|
| T |
14617159 |
tgcatatgcgggagctttagtgcaccgggttaccctt |
14617195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 27474302 - 27474437
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || || |||||| |||||||||||||| ||||| || |||||||||||||||| ||||||||||||| ||| | | || |
|
|
| T |
27474302 |
tgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaa-cagggcaaagctgcgtacaatacactgaatggtgggaccccttcccggaccc |
27474400 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||||| | |||||||| |
|
|
| T |
27474401 |
tgcgtatgcgggagctttagtgcaccggattgccctt |
27474437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 147
Target Start/End: Original strand, 46991828 - 46991959
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||||| ||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||| ||| | | || | | |
|
|
| T |
46991828 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgc |
46991927 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| |
|
|
| T |
46991928 |
gtatgtgggagctttagtgcaccgggttgccc |
46991959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 20004226 - 20004091
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||| |||||| || || ||||||||||| |||||||||||| |||||| ||||||||||||||| | ||||||||||||| ||| ||| || |
|
|
| T |
20004226 |
aaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacccc |
20004127 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||| |
|
|
| T |
20004126 |
gcatatgcgggagctttagtgcaccgggttgccctt |
20004091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 30395862 - 30395727
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | || |
|
|
| T |
30395862 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
30395763 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||| |
|
|
| T |
30395762 |
gcatatgcgggagctttagtgcaccgagttgccctt |
30395727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 27201668 - 27201806
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||||||| |||||| || || |||||||||||||||| | |||||||||||| ||||||||||||||| |||||||||||||| ||| | | | |
|
|
| T |
27201668 |
tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggac |
27201767 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
27201768 |
cttgcgtatgcgggagctttagtgcattgggttgccctt |
27201806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 138
Target Start/End: Original strand, 6925124 - 6925246
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||| |||||||||||||||||| |||||||| ||||| ||||||||| ||||||||||||| ||| | | || | | |
|
|
| T |
6925124 |
aaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccgaatggtgggaccccttcccggtccctgc |
6925223 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6925224 |
gtatgcgggagctttagtgcacc |
6925246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 13 - 139
Target Start/End: Complemental strand, 18724682 - 18724557
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||||||||||||| ||| ||||||||||| |||| |||||||| ||| | | || |
|
|
| T |
18724682 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaatcttgggaccccttcccggaccc |
18724583 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcacca |
139 |
Q |
| |
|
||| |||||||||||||| |||||||| |
|
|
| T |
18724582 |
tacatatgcgggagcttt-gtgcacca |
18724557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 38478417 - 38478283
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || | |||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||| |||| ||| | | || |
|
|
| T |
38478417 |
tgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcggaccc |
38478320 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
38478319 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
38478283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 41319943 - 41319807
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgc-agccc |
111 |
Q |
| |
|
|||||||||||| ||| || || || |||||| |||||||||||||||||||||||| ||||||||||||||| ||||| |||||||| ||| | | ||| |
|
|
| T |
41319943 |
tgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccgaaccc |
41319844 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|| | |||||||||| || ||||||| |||||||||| |
|
|
| T |
41319843 |
tt-catatgcgggagtttcagtgcactgggttgccctt |
41319807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 45402128 - 45402251
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt--aaga-ctgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcg |
122 |
Q |
| |
|
|||||| || || ||||||||||||||||||||| |||||| ||| ||||||||||||||| |||||||||||||| ||| ||| || | |||||||| |
|
|
| T |
45402128 |
gttcaagtcctggaaacagcctcttgtgtaaaaa-cagggttcaagttctgcgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcg |
45402226 |
T |
 |
| Q |
123 |
ggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
45402227 |
ggagctttagtgcaccgggttgccc |
45402251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 35253296 - 35253188
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| |
|
|
| T |
35253296 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
35253199 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
| |||||||| |
|
|
| T |
35253198 |
ggattgccctt |
35253188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 44 - 149
Target Start/End: Complemental strand, 1517418 - 1517312
Alignment:
| Q |
44 |
gcctcttgtgt-aaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggt |
142 |
Q |
| |
|
||||||||||| |||||||| | |||| ||||||||||||||| || ||||||||||| ||| ||| || | ||||||| |||||||||||||||| ||| |
|
|
| T |
1517418 |
gcctcttgtgttaaaaaacatgataaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggt |
1517319 |
T |
 |
| Q |
143 |
tgccctt |
149 |
Q |
| |
|
||||||| |
|
|
| T |
1517318 |
tgccctt |
1517312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 45264537 - 45264411
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
|||||||||||| |||||| || || ||||| ||||||||| ||||||||| ||||| ||| || ||||||| | |||||||||||||| ||| ||| || |
|
|
| T |
45264537 |
tgaaaggtcacatgttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagacc |
45264438 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
| | |||||||||||||||||||||| |
|
|
| T |
45264437 |
ctgcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 45812672 - 45812541
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || || |||||| ||||||||||||| | ||||||| |||| |||||||||| |||||||||||||| ||| || || |
|
|
| T |
45812672 |
tgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaaga--gggtaaggctgcatacaatacaccaaatggtgggaccccttcccaaaccc |
45812575 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgcc |
146 |
Q |
| |
|
| | |||||||||||| ||||||||| ||||||| |
|
|
| T |
45812574 |
tgcatatgcgggagctctagtgcaccgggttgcc |
45812541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 47214532 - 47214666
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||| ||||||| ||||| ||||||||| |||||||||||||| |||||||||||||| ||| ||| || |
|
|
| T |
47214532 |
tgaaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaa--cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccagaccc |
47214629 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||||| || ||||| |
|
|
| T |
47214630 |
tgcatatgcgggagctctagtgcaccagattaccctt |
47214666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 39 - 158
Target Start/End: Complemental strand, 31382324 - 31382206
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||| |||| |||| ||||||||||||||| |||||||||||||| ||| | || | | ||||||||||||||| || ||| |
|
|
| T |
31382324 |
aaacagcctcttgtgtaaaaa-caggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttactgtacc |
31382226 |
T |
 |
| Q |
139 |
aggttgcccttattgttttt |
158 |
Q |
| |
|
|||||||||| || ||||| |
|
|
| T |
31382225 |
gggttgcccttttttttttt |
31382206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 23796512 - 23796622
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||| || ||||| |||||||||||||| |||||||| ||||| ||| ||| || | | ||||| |||||||||||||||| |
|
|
| T |
23796512 |
aaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagtgcacc |
23796611 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|| ||||||| |
|
|
| T |
23796612 |
gggctgccctt |
23796622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 47 - 96
Target Start/End: Complemental strand, 4430129 - 4430080
Alignment:
| Q |
47 |
tcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4430129 |
tcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtggg |
4430080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 6983946 - 6983812
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || || |||||||||| || |||||||||||||||| |||||||||||||| |||||||||||||| || | | || |
|
|
| T |
6983946 |
tgaaaggtcacaggttcaagtcctggaaacagcctc--gtataaaaaacagggtaagtatgcgtacaatacaccaaatggtgggacccctttccggaccc |
6983849 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||| || |||||||| ||||||| || ||||||| |
|
|
| T |
6983848 |
tgcgtaggcaggagctttggtgcaccgggctgccctt |
6983812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 55 - 149
Target Start/End: Complemental strand, 18742054 - 18741958
Alignment:
| Q |
55 |
aaaaaacagggtaagactgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||| ||| ||| || | |||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
18742054 |
aaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttccctt |
18741958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 141
Target Start/End: Original strand, 19701617 - 19701720
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||||||||||||||||||| |||||| || |||||||||| | |||||||||| ||| ||| | | || | ||||||||||||||||||||||| |
|
|
| T |
19701617 |
aaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcac |
19701716 |
T |
 |
| Q |
138 |
cagg |
141 |
Q |
| |
|
|||| |
|
|
| T |
19701717 |
cagg |
19701720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 13 - 128
Target Start/End: Complemental strand, 25468400 - 25468285
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||| |||||| || || ||||| ||||||||||||||| ||||||||| |||||||||||||| ||||||| ||||| ||| ||| || |
|
|
| T |
25468400 |
tgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatggttggacctcttcccagaccc |
25468301 |
T |
 |
| Q |
113 |
tacgtatgcgggagct |
128 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
25468300 |
tgcgtatgcgggagct |
25468285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 2435924 - 2435798
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
||||||||||| |||||| || || |||||||||| ||||| ||||| |||||||| |||||||||||||| | |||||||||||||| || | || |
|
|
| T |
2435924 |
tgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaaaatggtgggacccctttccgtacc |
2435825 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
| || ||||||||||||||||||||| |
|
|
| T |
2435824 |
ctccgcatgcgggagctttagtgcacc |
2435798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 57 - 147
Target Start/End: Complemental strand, 10378828 - 10378738
Alignment:
| Q |
57 |
aaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||| ||| | || | | |||||||||||||||||||||| || ||||| |
|
|
| T |
10378828 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 39 - 85
Target Start/End: Complemental strand, 17470457 - 17470411
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17470457 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacac |
17470411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 49 - 148
Target Start/End: Complemental strand, 19932856 - 19932755
Alignment:
| Q |
49 |
ttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc |
146 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||| || | |||||||||||||||||| |
|
|
| T |
19932856 |
ttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgcc |
19932757 |
T |
 |
| Q |
147 |
ct |
148 |
Q |
| |
|
|| |
|
|
| T |
19932756 |
ct |
19932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 44 - 149
Target Start/End: Original strand, 8197095 - 8197200
Alignment:
| Q |
44 |
gcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggtt |
143 |
Q |
| |
|
||||||||||||||||||| |||||| || |||||| ||||| ||||||| |||||| ||| | | || | |||||| |||||||||||| ||| |||| |
|
|
| T |
8197095 |
gcctcttgtgtaaaaaacatggtaaggctacgtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggtt |
8197194 |
T |
 |
| Q |
144 |
gccctt |
149 |
Q |
| |
|
|||||| |
|
|
| T |
8197195 |
gccctt |
8197200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 19414460 - 19414594
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || | ||| |||||||| ||||||| |||| |||| ||||||||||||||| |||||||||||||| ||| | || |
|
|
| T |
19414460 |
tgaaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaa--caggttaaggctgcgtacaatacaccaaatggtgggaccccttcccgtaccc |
19414557 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
19414558 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
19414594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 138
Target Start/End: Original strand, 35019251 - 35019375
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||| |||||| ||| |||| |||| |||||||||| || ||||||||||| || ||| || |
|
|
| T |
35019251 |
tgaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaattggtgggaccc-ctcccagaccc |
35019349 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
| |||||||| ||||||||||||||| |
|
|
| T |
35019350 |
tgcgtatgcgagagctttagtgcacc |
35019375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 9939482 - 9939621
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa--tggtgggaccct-ttcgcagc |
109 |
Q |
| |
|
||||||||||| ||||||| || || ||||| |||||||| ||| ||||| |||||| ||||| |||||||| ||| ||||||||||| ||| | | |
|
|
| T |
9939482 |
tgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatggtgggacccccttctcgga |
9939581 |
T |
 |
| Q |
110 |
ccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|| | |||||||||||||||||||||||| |||| ||||| |
|
|
| T |
9939582 |
ccctgcgtatgcgggagctttagtgcaccgggttaccctt |
9939621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 39 - 95
Target Start/End: Complemental strand, 34679330 - 34679274
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgg |
95 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
34679330 |
aaacaacctcttgtgtaaaaaacagggtaagactgcgtactatacatcaaatggtgg |
34679274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 55 - 138
Target Start/End: Original strand, 46859129 - 46859213
Alignment:
| Q |
55 |
aaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||| | || ||| |||| |||||| ||||| ||||||||||| |
|
|
| T |
46859129 |
aaaaaacagggtaagactgcgtacaatacaccaaaatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcacc |
46859213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 39 - 130
Target Start/End: Original strand, 11596560 - 11596650
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttt |
130 |
Q |
| |
|
||||| |||||||||||||| |||||||||| ||||||| ||||||| |||||||||||||| ||| | || | |||||||||||||||| |
|
|
| T |
11596560 |
aaacaacctcttgtgtaaaa-acagggtaaggctgcgtataatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttt |
11596650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 39 - 137
Target Start/End: Complemental strand, 12126946 - 12126850
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||| |||||||||||| ||||||||| ||||||||||||||| |||| ||||||||| ||| | | || | | |||||||||||| |||||||| |
|
|
| T |
12126946 |
aaacagcttcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcac |
12126850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 58 - 149
Target Start/End: Original strand, 43768205 - 43768296
Alignment:
| Q |
58 |
aaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||| |||| |||||||||| || ||||||||||| ||| ||| || | ||||| ||||||||||| |||||| || ||||||| |
|
|
| T |
43768205 |
aaacagggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccctt |
43768296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 39 - 130
Target Start/End: Complemental strand, 44485220 - 44485129
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttt |
130 |
Q |
| |
|
||||| || ||||||||||| ||| |||||| ||||||||||||||| ||||||| |||||| ||| | | | |||||||||||||||||| |
|
|
| T |
44485220 |
aaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacaccaaatggttggaccccttcccggatcctacgtatgcgggagcttt |
44485129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 60 - 130
Target Start/End: Original strand, 15505632 - 15505702
Alignment:
| Q |
60 |
acagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttt |
130 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||| | || | |||||||||||||||| |
|
|
| T |
15505632 |
acagggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt |
15505702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 39 - 136
Target Start/End: Original strand, 43207542 - 43207640
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa-tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
||||| |||||| ||| |||||||||||||||| || |||||||||| ||| |||||||||| ||| ||| || || ||||||| ||||||||||||| |
|
|
| T |
43207542 |
aaacaacctcttatgtgaaaaacagggtaagacggcatacaatacaccaaattggtgggacctcttcccagaccctatgtatgcgagagctttagtgca |
43207640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 22324927 - 22325049
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcccttacgtatgcgg |
123 |
Q |
| |
|
|||||| || || |||||||||||||||| |||||||||||||| |||| |||||||||| ||||||||| ||| || | | || | ||||||||| |
|
|
| T |
22324927 |
gttcaagtcttggaaacagcctcttgtgt-aaaaacagggtaaggctgcatacaatacaccaaaaatggtggagccccgtc-ccgaccctgcgtatgcgg |
22325024 |
T |
 |
| Q |
124 |
gagctttagtgcaccaggttgccct |
148 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
22325025 |
gagctttagtgcaccaggctgccct |
22325049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 35117905 - 35117777
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || ||| |||||||||||||||| |||||||||| ||| ||||||||||| ||||| |||||||| ||| | | | |
|
|
| T |
35117905 |
tgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggac |
35117806 |
T |
 |
| Q |
111 |
cttacgt-atgcgggagctttagtgcacc |
138 |
Q |
| |
|
| | ||| |||| |||||||||||||||| |
|
|
| T |
35117805 |
cctgcgtaatgcaggagctttagtgcacc |
35117777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 147
Target Start/End: Complemental strand, 39215094 - 39214961
Alignment:
| Q |
15 |
aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata-cactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
||||||| ||||||||| | || ||||| ||||||||||||||||| ||||||| |||||||||||| | |||||||||| ||| ||| || || | |
|
|
| T |
39215094 |
aaaggtcccaagttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaatggtgggtccccttcccaaaccct |
39214995 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
|||||| || |||||||||||||| || ||||| |
|
|
| T |
39214994 |
gcgtatgtggaagctttagtgcaccgggctgccc |
39214961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 18335425 - 18335305
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||||||| || || || |||||| ||||||| |||||| ||||||| ||||||||||||| ||||| |||||||||||| || || |
|
|
| T |
18335425 |
tgaaaggtcacaagttaaagtcctggaaacagtctcttgtttaaaaattagggtaaagttgcgtacaatacatcaaatgatgggaccctttcctagacca |
18335326 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagt |
133 |
Q |
| |
|
| |||| ||||||||||||| |
|
|
| T |
18335325 |
tgtgtatacgggagctttagt |
18335305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 93
Target Start/End: Original strand, 24564365 - 24564445
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggt |
93 |
Q |
| |
|
||||||||| || ||||| || || ||||| ||||||||||||||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
24564365 |
tgaaaggtcgcagattcaagtcttggaaacaacctcttgtgtaaaaaacagggtaagggtgcgtacaattcaccaaatggt |
24564445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 56 - 149
Target Start/End: Complemental strand, 42304303 - 42304208
Alignment:
| Q |
56 |
aaaaacagggtaagactgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| ||||||||||| ||| | | || | |||||| ||||||||||||||||| | |||||||| |
|
|
| T |
42304303 |
aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccctt |
42304208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 148
Target Start/End: Complemental strand, 15511288 - 15511150
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcg--tacaataca-ctaaatggtgggaccctttcgcagc |
109 |
Q |
| |
|
|||||||||||| || || || || |||| |||||||||||||||||||||||||| ||||| ||||||||| | ||||||||| |||| ||| | |
|
|
| T |
15511288 |
tgaaaggtcacatattgaagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacaccaaaatggtggtaccccttcctgga |
15511189 |
T |
 |
| Q |
110 |
ccttacgtatgcgggagctttagtgcaccaggttgccct |
148 |
Q |
| |
|
|| | |||||| | ||||||||||||||| || |||||| |
|
|
| T |
15511188 |
ccctgcgtatgtgtgagctttagtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 149
Target Start/End: Complemental strand, 20999957 - 20999851
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagc-ccttacgtatgcgggagctttagtgcaccagg |
141 |
Q |
| |
|
|||| ||||||||||||||| || ||| ||||||||||||||| ||||| |||| ||| ||| | || || | |||| ||||||||||||||||||| || |
|
|
| T |
20999957 |
agccacttgtgtaaaaaacaaggcaaggctgcgtacaatacaccaaatgatggggccccttc-cggcaccctgcgtacgcgggagctttagtgcaccggg |
20999859 |
T |
 |
| Q |
142 |
ttgccctt |
149 |
Q |
| |
|
||||||| |
|
|
| T |
20999858 |
ctgccctt |
20999851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 26 - 144
Target Start/End: Original strand, 30682848 - 30682963
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
||||||||| || ||| |||||||||||| ||||||| ||||||| || |||| ||||| |||||||||||||| ||| | | || | ||||||||||| |
|
|
| T |
30682848 |
gttcaaatcctgaaaatagcctcttgtgt-aaaaacaaggtaagattgtgtac-atacaacaaatggtgggaccccttcccggaccgtgcgtatgcggga |
30682945 |
T |
 |
| Q |
126 |
gctttagtgcaccaggttg |
144 |
Q |
| |
|
||||| |||||||| |||| |
|
|
| T |
30682946 |
gcttt-gtgcaccaagttg |
30682963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 40 - 100
Target Start/End: Complemental strand, 27136762 - 27136701
Alignment:
| Q |
40 |
aacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccc |
100 |
Q |
| |
|
|||| |||||||||||||||||| |||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
27136762 |
aacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaaatggtgggaccc |
27136701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 52910238 - 52910311
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgt-aaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
|||||||||||| |||||| || || |||||||||||| || ||||||||||||| ||||| ||||||||||| |
|
|
| T |
52910238 |
tgaaaggtcacaggttcaactcttggaaacagcctcttaggtaaaaaaacagggtaggactgtgtacaatacac |
52910311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 85
Target Start/End: Complemental strand, 50760359 - 50760291
Alignment:
| Q |
17 |
aggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
||||||| |||||| || || ||||||||||||||||| ||||| ||||||| ||||||| ||||||| |
|
|
| T |
50760359 |
aggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgtataatacac |
50760291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 13 - 96
Target Start/End: Complemental strand, 31272511 - 31272429
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggg |
96 |
Q |
| |
|
|||||||||||| |||||| || || ||||| ||||||||||| |||||| |||||| ||||||||| ||| |||||||||| |
|
|
| T |
31272511 |
tgaaaggtcacaggttcaagtcctggaaacaacctcttgtgta-aaaacatggtaaggctgcgtacagcacatcaaatggtggg |
31272429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 104
Target Start/End: Complemental strand, 19656217 - 19656151
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttc |
104 |
Q |
| |
|
|||||||||||||||||||||||| ||||| || |||||||||| | ||||||| |||||||||| |
|
|
| T |
19656217 |
aaacagcctcttgtgtaaaaaacatggtaacgctatgtacaatacaccaaaatggtaggaccctttc |
19656151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 100
Target Start/End: Original strand, 33223031 - 33223092
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccc |
100 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| ||||||||||||| | |||||||||||||| |
|
|
| T |
33223031 |
aaacagcctcttgtgt-aaaaacagggaaaggttgcgtacaatacaccaaaatggtgggaccc |
33223092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 149
Target Start/End: Original strand, 50606498 - 50606560
Alignment:
| Q |
87 |
aaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||| ||| | | || | | |||||||||||||||||||||| |||||||||| |
|
|
| T |
50606498 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
50606560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 22327120 - 22327185
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtac |
78 |
Q |
| |
|
||||||||| | |||||| || || ||||| ||||||||||||||||||||||||| ||| |||| |
|
|
| T |
22327120 |
tgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtac |
22327185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 13 - 138
Target Start/End: Original strand, 23371145 - 23371268
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || | |||||||| |||| ||||||||| ||| ||| || ||||||||||| ||||| |||||||| ||| ||| || |
|
|
| T |
23371145 |
tgaaaggtcacgggttcaagtcctagaaacagccacttgggtaaaaaac-gggcaaggttgtgtacaatacaccaaatgctgggaccccttc-cagaccc |
23371242 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
| |||||| || |||||||||||||| |
|
|
| T |
23371243 |
tgcgtatgtggtagctttagtgcacc |
23371268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 39 - 100
Target Start/End: Complemental strand, 34149071 - 34149010
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||||||||| |||| |||||||| ||||||||| | || |||||||| ||||| |
|
|
| T |
34149071 |
aaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccc |
34149010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 100
Target Start/End: Original strand, 20036241 - 20036329
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaa-aaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||||||||||| | | ||||||||| ||||| |||||||| ||||||||| |||| |
|
|
| T |
20036241 |
tgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacaccaaatggtggaaccc |
20036329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 83
Target Start/End: Complemental strand, 20169200 - 20169156
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatac |
83 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
20169200 |
aaacaccctcttgtgtaaaaaaaaaggtaagactgtgtacaatac |
20169156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 100
Target Start/End: Complemental strand, 21910743 - 21910699
Alignment:
| Q |
56 |
aaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
21910743 |
aaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccc |
21910699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 69
Target Start/End: Original strand, 25290214 - 25290242
Alignment:
| Q |
41 |
acagcctcttgtgtaaaaaacagggtaag |
69 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25290214 |
acagcctcttgtgtaaaaaacagggtaag |
25290242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 57)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 13 - 152
Target Start/End: Complemental strand, 11617725 - 11617586
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || || ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| | || |
|
|
| T |
11617725 |
tgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctggaccc |
11617626 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgcccttatt |
152 |
Q |
| |
|
| ||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
11617625 |
tgcgtatgcaggacctttagtgcaccgggttgcccttatt |
11617586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 2541155 - 2541020
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||| ||| | | || | |
|
|
| T |
2541155 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtactatacaccaaatggtgggaccccttcccggtccct |
2541056 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |
|
|
| T |
2541055 |
gcgtatgcgggagctttagtgcaccgggtttccctt |
2541020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 15 - 149
Target Start/End: Complemental strand, 23419809 - 23419675
Alignment:
| Q |
15 |
aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctta |
114 |
Q |
| |
|
|||||||||| |||||| | || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| || |||| |
|
|
| T |
23419809 |
aaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctagaccttg |
23419710 |
T |
 |
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||| |||||| ||||||||||| | || ||||||| |
|
|
| T |
23419709 |
cgtgtgcgggggctttagtgcatcgggctgccctt |
23419675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 14 - 158
Target Start/End: Complemental strand, 19427025 - 19426882
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||||| |||||| || || |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||| | | || | |
|
|
| T |
19427025 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacaccaaatggtgggaccc-ttctcggaccct |
19426927 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgcccttattgttttt |
158 |
Q |
| |
|
| |||||| |||||| |||||||| |||||||||| || ||||| |
|
|
| T |
19426926 |
gcatatgcgagagcttcagtgcaccgggttgcccttttttttttt |
19426882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 16 - 158
Target Start/End: Original strand, 7879639 - 7879781
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||||| ||||||||||||||||| |||||| ||||||||||||||| |||||||||||||| ||| | | || | | |
|
|
| T |
7879639 |
aaggtcacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
7879738 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgcccttattgttttt |
158 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| || ||||| |
|
|
| T |
7879739 |
gtatgcgggagcttcagtgcaccgggttgcccttttttttttt |
7879781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 21172144 - 21172010
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
21172144 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
21172047 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
21172046 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
21172010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 31591244 - 31591110
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| ||||||| || || ||||| |||||||||||||| ||| ||||| |||||||||||||| ||||||||||||||| ||| | | ||| |
|
|
| T |
31591244 |
tgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaa--cagagtaaggctgcgtacaatacaataaatggtgggaccccttcccggacct |
31591147 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
31591146 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
31591110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 32758259 - 32758393
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || || |||||||||||||||||||| ||||||||| ||| ||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
32758259 |
tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccc |
32758356 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
32758357 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
32758393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 42798670 - 42798803
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || |||||| ||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||| | | || | | |
|
|
| T |
42798670 |
aaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgc |
42798769 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||| |
|
|
| T |
42798770 |
atatgcgggagctatagtgcatcgggttgccctt |
42798803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 149
Target Start/End: Original strand, 27629633 - 27629768
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||| ||| | | || | |
|
|
| T |
27629633 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacaccaaatggtgggaccccttcccgggccct |
27629732 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||||||| ||||| |||||||| |||||||||| |
|
|
| T |
27629733 |
gcatatgcggtagcttcagtgcaccgggttgccctt |
27629768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 33872046 - 33871914
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||| | |||||| || || ||||| ||||||||||||||| |||| |||| ||||||||||||||| |||||||||||||| ||| ||| || |
|
|
| T |
33872046 |
tgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaa-caggataaggctgcgtacaatacaccaaatggtgggaccccttcccagaccc |
33871948 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgcc |
146 |
Q |
| |
|
| ||||||| ||||||||||||||||||||||| |
|
|
| T |
33871947 |
tgtgtatgcgagagctttagtgcaccaggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 42391235 - 42391101
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||||||| |||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
42391235 |
tgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
42391138 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
42391137 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
42391101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 42805525 - 42805660
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||||||||||||| ||| ||||||||||| | ||||||||||||| ||| | | || |
|
|
| T |
42805525 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggacccc |
42805624 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||| |
|
|
| T |
42805625 |
gcatatgcgggagctttagtgcaccgggttgccctt |
42805660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 47716460 - 47716595
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | || |
|
|
| T |
47716460 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
47716559 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||| ||||||| |||||||||| |
|
|
| T |
47716560 |
gcatatgcgggagctttggtgcaccgggttgccctt |
47716595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 10693208 - 10693074
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| | ||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
10693208 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaga--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
10693111 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| |||||||| |||||||||| |
|
|
| T |
10693110 |
tgcatatgcgggagctctagtgcactgggttgccctt |
10693074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 130
Target Start/End: Complemental strand, 28362282 - 28362165
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || | |||| |||||||||||||||||| |||||| ||||||||||||||| |||||||||||||| ||| ||| ||| |
|
|
| T |
28362282 |
tgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagacct |
28362183 |
T |
 |
| Q |
113 |
tacgtatgcgggagcttt |
130 |
Q |
| |
|
| | |||| ||||||||| |
|
|
| T |
28362182 |
tgcatatgtgggagcttt |
28362165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 16 - 148
Target Start/End: Complemental strand, 35334948 - 35334818
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| ||||||| || || |||||| ||| ||||||||||||||||||||||| ||||||||||| ||||||||||||| ||| | | || | | |
|
|
| T |
35334948 |
aaggtcacgagttcaagtcctggaaacagtctc--gtgtaaaaaacagggtaagactgtgtacaatacaccgaatggtgggaccccttcccggaccctgc |
35334851 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccct |
148 |
Q |
| |
|
|||||| |||||||||||||||| |||| |||| |
|
|
| T |
35334850 |
gtatgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 40 - 149
Target Start/End: Complemental strand, 35787378 - 35787270
Alignment:
| Q |
40 |
aacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacca |
139 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||||||| |||||| ||||||| ||| | | |||| ||||||||||||||| | |||||| |
|
|
| T |
35787378 |
aacagcctcttgtgtaaaaa-catggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccg |
35787280 |
T |
 |
| Q |
140 |
ggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
35787279 |
ggttgccctt |
35787270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 158
Target Start/End: Original strand, 43557470 - 43557618
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||||||||||||||| ||||| ||||||||||||||| | ||||||||||||| || | | | |
|
|
| T |
43557470 |
tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggac |
43557569 |
T |
 |
| Q |
111 |
cttacgtatgcgggagc-tttagtgcaccaggttgcccttattgttttt |
158 |
Q |
| |
|
| ||||||||||||| ||||||||||| |||||||||| || ||||| |
|
|
| T |
43557570 |
tctgcgtatgcgggagcttttagtgcaccgggttgcccttttttttttt |
43557618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 19265813 - 19265947
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || | |||||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
19265813 |
tgaaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaag-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacc- |
19265910 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||| |||| ||||||||||||||||| || ||||||| |
|
|
| T |
19265911 |
tacatatgtgggagctttagtgcaccgggctgccctt |
19265947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 34626344 - 34626209
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||| |||| ||||| || || |||||||||| |||||||||| ||||||||| |||||| |||||||| ||||||||||| || ||| | | || |
|
|
| T |
34626344 |
tgaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaa-cagggtaaggctgcgttcaatacaccaaatggtgggatcccttcccggaccc |
34626246 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||||||||||||||||||| || | |||||||||| |
|
|
| T |
34626245 |
tgcgtatgcgggagctttagttcatcgggttgccctt |
34626209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 16 - 135
Target Start/End: Complemental strand, 42102019 - 42101899
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa-tggtgggaccctttcgcagccctta |
114 |
Q |
| |
|
||||||| |||||||| || || |||||||||||| |||||||||||||||| |||||||||| ||| ||||| ||||||||||||||| | | || | |
|
|
| T |
42102019 |
aaggtcaaaagttcaagtcctggaaacagcctcttccgtaaaaaacagggtaacactgcgtacagtactctaaagtggtgggaccctttcccggaccctg |
42101920 |
T |
 |
| Q |
115 |
cgtatgcgggagctttagtgc |
135 |
Q |
| |
|
||||| ||| ||||||||||| |
|
|
| T |
42101919 |
cgtatccggcagctttagtgc |
42101899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 46 - 149
Target Start/End: Complemental strand, 22699074 - 22698968
Alignment:
| Q |
46 |
ctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccc-tttcgcagcccttacgtatgcgggagctttagtgcaccaggt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| | | || | ||||||||||||| ||||||||| ||| |
|
|
| T |
22699074 |
ctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggt |
22698975 |
T |
 |
| Q |
143 |
tgccctt |
149 |
Q |
| |
|
| ||||| |
|
|
| T |
22698974 |
taccctt |
22698968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 42476897 - 42477005
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||| ||||||||||||| || |||||| ||||||||||||||| |||||||||||||| ||| || | | | |||||||||||| ||||||||| |
|
|
| T |
42476897 |
aaacagtctcttgtgtaaaa--caaggtaaggctgcgtacaatacaccaaatggtgggaccccttcctaggctctgcatatgcgggagctctagtgcacc |
42476994 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
||||||||||| |
|
|
| T |
42476995 |
aggttgccctt |
42477005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 48123621 - 48123534
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
48123621 |
tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacaccaaatggtgggaccc |
48123534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 48735231 - 48735123
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||| |||||||||||||| || |||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| |
|
|
| T |
48735231 |
aaacaacctcttgtgtaaaacac--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
48735134 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
48735133 |
gggttgccctt |
48735123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 43 - 149
Target Start/End: Complemental strand, 14099113 - 14099008
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggt |
142 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||| ||| | || ||||||||| |||| ||| ||||||||| |
|
|
| T |
14099113 |
agccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatgcaggagattt-ttgcaccaggc |
14099015 |
T |
 |
| Q |
143 |
tgccctt |
149 |
Q |
| |
|
||||||| |
|
|
| T |
14099014 |
tgccctt |
14099008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 43 - 149
Target Start/End: Complemental strand, 14409130 - 14409025
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggt |
142 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||| ||| | || ||||||||| |||| ||| ||||||||| |
|
|
| T |
14409130 |
agccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatgcaggagattt-ttgcaccaggc |
14409032 |
T |
 |
| Q |
143 |
tgccctt |
149 |
Q |
| |
|
||||||| |
|
|
| T |
14409031 |
tgccctt |
14409025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 14 - 148
Target Start/End: Complemental strand, 18512588 - 18512455
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||||| |||||| || || ||||| | ||||||||||||| |||||||| ||||||||||||||| ||||||||||||| ||| | | || | |
|
|
| T |
18512588 |
gaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccct |
18512490 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccct |
148 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| |
|
|
| T |
18512489 |
gcgtatgcgggagctttggtgcactgggttgccct |
18512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 29907417 - 29907552
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
||||||||||| |||||| || | |||||||||||||||||||||| || ||||| |||||| ||||||| | |||||||||||||| || | | || |
|
|
| T |
29907417 |
tgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaaaatggtgggaccccatcccggacc |
29907516 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
29907517 |
ct--gtatgcgggagctttagtgcaccgggttgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 40463901 - 40464010
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||| |||||||||||||| | ||||||| ||||||| ||||||| |||||||||||||| ||| | | || | ||||||||||||||| |||||||| |
|
|
| T |
40463901 |
aaacagtctcttgtgtaaaaa-ctgggtaaggctgcgtataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcacc |
40463999 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
||||||||| |
|
|
| T |
40464000 |
gagttgccctt |
40464010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 39 - 155
Target Start/End: Original strand, 16341302 - 16341419
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||| | |||||||||| || ||| | | ||| | |||||||||||||| |||||| |
|
|
| T |
16341302 |
aaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaatggtgggccctcttcccggacctatcatatgcgggagctttggtgcac |
16341401 |
T |
 |
| Q |
138 |
caggttgcccttattgtt |
155 |
Q |
| |
|
| || |||||||| |||| |
|
|
| T |
16341402 |
cgggctgcccttaatgtt |
16341419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 18747484 - 18747621
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
||||||||||| | |||| || || ||||||||| |||||||||||| ||||||||| ||||||| ||||||| || ||||||||||| ||| || |
|
|
| T |
18747484 |
tgaaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggaccccttcctgaacc |
18747583 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||||| || ||||||| |
|
|
| T |
18747584 |
ctgcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 7644954 - 7645026
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7644954 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacac |
7645026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 21566439 - 21566559
Alignment:
| Q |
19 |
gtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgt |
117 |
Q |
| |
|
|||||| |||||| || || |||| |||||||||||||||||||| | |||||||||||||||||| | ||||||| |||||| ||| | || | | | |
|
|
| T |
21566439 |
gtcacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcat |
21566538 |
T |
 |
| Q |
118 |
atgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21566539 |
atgcgggagctttagtgcacc |
21566559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 131
Target Start/End: Original strand, 38604551 - 38604642
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttta |
131 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |||||||| ||||| || | | || | ||||||||||||||||| |
|
|
| T |
38604551 |
aaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagcttta |
38604642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 46354195 - 46354281
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccc |
100 |
Q |
| |
|
|||||||| |||||| || || ||||| ||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
46354195 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccc |
46354281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 26 - 103
Target Start/End: Complemental strand, 2663057 - 2662982
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacccttt |
103 |
Q |
| |
|
|||||| || || |||||||||||||||||||| | ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
2663057 |
gttcaagtcctggaaacagcctcttgtgtaaaata--gggtaaggctgcgtacaatacaccaaatggtgggacccttt |
2662982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 52 - 149
Target Start/End: Complemental strand, 23619075 - 23618978
Alignment:
| Q |
52 |
tgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||| ||||||| ||||| || |||||||||| |||||||||||||| ||||||| |||| ||| ||| |||||||||||||| | |||||||||| |
|
|
| T |
23619075 |
tgtataaaacagagtaagcttgtgtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgccctt |
23618978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 149
Target Start/End: Complemental strand, 8149077 - 8148947
Alignment:
| Q |
19 |
gtcacaagttcaaatcgtgtaaacagcctcttgtgt-aaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgt |
117 |
Q |
| |
|
||||| ||||||| || || |||| |||||||||| |||||| |||||||| |||||||||||||| |||||||||||||| ||| ||| ||| ||| |
|
|
| T |
8149077 |
gtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccag-acttgcgt |
8148979 |
T |
 |
| Q |
118 |
atgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||| ||| ||||||||| ||| || ||||| |
|
|
| T |
8148978 |
atgcgagagttttagtgcatcagattaccctt |
8148947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 26 - 129
Target Start/End: Original strand, 19266461 - 19266564
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || || ||| |||| |||| ||||||||||||||||| ||||||||||||||| |||| |||||| || ||| | | || | ||||||||||| |
|
|
| T |
19266461 |
gttcaagtcctgaaaatagccacttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaattgtgggatcccttcccggaccctgcgtatgcggga |
19266560 |
T |
 |
| Q |
126 |
gctt |
129 |
Q |
| |
|
|||| |
|
|
| T |
19266561 |
gctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 71 - 149
Target Start/End: Complemental strand, 27889395 - 27889317
Alignment:
| Q |
71 |
ctgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| | | || | |||||||||||||||| || |||| |||||||||| |
|
|
| T |
27889395 |
ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctt |
27889317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 47077990 - 47077867
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||| ||||||||||||| | || ||| |||||||||||||| |||||||||||||| ||| || || |
|
|
| T |
47077990 |
tgaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaatagag--taaagttgcgtacaatacacaaaatggtgggaccccttcccaaaccc |
47077893 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||| |||||||||||| ||||||||| |
|
|
| T |
47077892 |
tacatatgcgggagctctagtgcacc |
47077867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 100
Target Start/End: Original strand, 1408485 - 1408542
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
1408485 |
agcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccc |
1408542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 35203437 - 35203506
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata |
82 |
Q |
| |
|
||||||||||| |||||| || || ||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35203437 |
tgaaaggtcacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaata |
35203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 38262330 - 38262197
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || |||||| ||||||||||||||| | ||||| ||| |||||||||| ||||| |||||||| ||| | | | | |
|
|
| T |
38262330 |
aaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcccgaacactgc |
38262231 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| |
|
|
| T |
38262230 |
gtatgcgggagctttagtgcaccggattgccctt |
38262197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 39 - 145
Target Start/End: Original strand, 25198749 - 25198856
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
|||||| || |||||||||||| || |||||||| ||||| ||| ||||||||||| ||| || ||| ||| || | |||||| | |||||||||||||| |
|
|
| T |
25198749 |
aaacagtcttttgtgtaaaaaaacaaggtaagaccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcac |
25198848 |
T |
 |
| Q |
138 |
caggttgc |
145 |
Q |
| |
|
| |||||| |
|
|
| T |
25198849 |
cgggttgc |
25198856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 39 - 85
Target Start/End: Complemental strand, 5180268 - 5180222
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||| |||| |
|
|
| T |
5180268 |
aaacagcctcttgtgtcaaaaacagggtaagactgtgtacaacacac |
5180222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 158
Target Start/End: Original strand, 11741793 - 11741936
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||| |||||| || || ||||||| ||| |||||||| | ||||||| ||||||||||||||| ||||||||||| || ||| | | |
|
|
| T |
11741793 |
tgaaaggtcatgggttcaagtcctgaaaacagcttctagtgtaaaata--gggtaaggctgcgtacaatacaccaaatggtgggatcccttcccggattc |
11741890 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgcccttattgttttt |
158 |
Q |
| |
|
| | ||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
11741891 |
tgcacatgcgggagctctagtgcaccgggttgcccttatagttttt |
11741936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 115 - 149
Target Start/End: Complemental strand, 45018958 - 45018924
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45018958 |
cgtatgcgggagctttagtgcaccaggttgccctt |
45018924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 12473302 - 12473374
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
|||||||||| |||||| || || ||||| |||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
12473302 |
tgaaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagggtaaggatgcgtacaatacac |
12473374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 13 - 60
Target Start/End: Complemental strand, 1524323 - 1524276
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa |
60 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||| |||| |
|
|
| T |
1524323 |
tgaaaggtcacaagttcaagtcttataaacagcctcttgtgtataaaa |
1524276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 138
Target Start/End: Original strand, 23231585 - 23231680
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||| | | |||||| ||||||| ||||||| |||| |||||||| ||| | || | ||||||||| |||||||||||||| |
|
|
| T |
23231585 |
agcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcacc |
23231680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 95
Target Start/End: Original strand, 6736888 - 6736969
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgg |
95 |
Q |
| |
|
||||||||||| |||||| || | ||||| |||||||| |||||| || ||||||||||| |||||||||| ||||||||| |
|
|
| T |
6736888 |
tgaaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaa-caaggtaagactgcatacaatacaccaaatggtgg |
6736969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Original strand, 36602547 - 36602581
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
36602547 |
cgtatgcgggagctttagtgcaccgggttgccctt |
36602581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 32233271 - 32233188
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggga |
97 |
Q |
| |
|
|||||||||| |||||| || || ||||| ||||||||||||||| ||||||||| | ||||| | ||||| ||||||||||| |
|
|
| T |
32233271 |
tgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaa-cagggtaaggcagcgtatattacaccaaatggtggga |
32233188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 135
Target Start/End: Original strand, 33500556 - 33500635
Alignment:
| Q |
58 |
aaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgc |
135 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||| ||| | | || | ||||||||||| ||| ||||| |
|
|
| T |
33500556 |
aaacagggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtgc |
33500635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 52)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 36720797 - 36720930
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |
|
|
| T |
36720797 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
36720896 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| |
|
|
| T |
36720897 |
gtatgcggaagctttagtgcacccggttgccctt |
36720930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 28817760 - 28817627
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||| | | || | | |
|
|
| T |
28817760 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgc |
28817661 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |
|
|
| T |
28817660 |
gtatgcgggagctttagtgcatcgggttgccctt |
28817627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 39 - 151
Target Start/End: Original strand, 45071289 - 45071400
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| ||| | | |||| ||||||||||||||| |||||||| |
|
|
| T |
45071289 |
aaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcacc |
45071387 |
T |
 |
| Q |
139 |
aggttgcccttat |
151 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45071388 |
gggttgcccttat |
45071400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 16 - 145
Target Start/End: Complemental strand, 29521819 - 29521690
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || |||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||| || || ||| || | | |
|
|
| T |
29521819 |
aaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgc |
29521720 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgc |
145 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
29521719 |
gtatgcgggagctttagtgcaccgggttgc |
29521690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 148
Target Start/End: Original strand, 29877118 - 29877227
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||||||||| |||||||||| |
|
|
| T |
29877118 |
aaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcacc |
29877217 |
T |
 |
| Q |
139 |
aggttgccct |
148 |
Q |
| |
|
||| |||||| |
|
|
| T |
29877218 |
aggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 44530150 - 44530283
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | || | | |
|
|
| T |
44530150 |
aaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgc |
44530249 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| |
|
|
| T |
44530250 |
gtatgcgggagctttagtgcaccgggttgacctt |
44530283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 14 - 149
Target Start/End: Original strand, 2626518 - 2626656
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaa---aacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||||||| |||||| || || |||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||| ||| ||| | |
|
|
| T |
2626518 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaatgatgggaccccttcccagac |
2626617 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | | ||||||||||||| |||||||||| |||||||| |
|
|
| T |
2626618 |
cctgcatatgcgggagcttcagtgcaccagattgccctt |
2626656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 39461133 - 39460995
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||||||| ||||| ||||||||||||||| | ||||||| ||||| ||| | | | |
|
|
| T |
39461133 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggac |
39461034 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
39461033 |
cctgcgtatgcgggagctttagtgcaccgggttgccctt |
39460995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 13 - 151
Target Start/End: Original strand, 22598155 - 22598292
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| ||||||||| || ||||| ||||||||||||||||||||||||| || ||||||||||| || ||||| ||||||||| | | ||| |
|
|
| T |
22598155 |
tgaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaattggtgagaccctttcccggacct |
22598254 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgcccttat |
151 |
Q |
| |
|
| ||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
22598255 |
tgcgtatgcggga-ctttagtgcaccaggcagcccttat |
22598292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 35261703 - 35261813
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||| | || | |||||||||||||||||||||||| |
|
|
| T |
35261703 |
aaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcacc |
35261802 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
35261803 |
gggttgccctt |
35261813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 12625913 - 12626024
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||| |||||||||| |||||||||||||| || | | || | ||||||||||||||||||||||| |
|
|
| T |
12625913 |
aaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacaccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcac |
12626012 |
T |
 |
| Q |
138 |
caggttgccctt |
149 |
Q |
| |
|
| |||||||||| |
|
|
| T |
12626013 |
cgggttgccctt |
12626024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 13160726 - 13160835
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||||||||||| ||||| || |
|
|
| T |
13160726 |
aaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgcc |
13160824 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
13160825 |
gggttgccctt |
13160835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 12670385 - 12670251
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
12670385 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
12670288 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||| ||||| |
|
|
| T |
12670287 |
tgcatatgcgggagctctagtgcaccgggttaccctt |
12670251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 26954133 - 26954269
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaa--atggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||| |||||| || || |||||||||||||||||||||| ||||||||| ||||||||||||||| || |||||||||||| ||| ||| ||| |
|
|
| T |
26954133 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacct |
26954232 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||| |
|
|
| T |
26954233 |
cgcatatgcgggagctttagtgcactgggttgccctt |
26954269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 6760823 - 6760958
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||||||||||||| || |||||||||||| | ||||||||||||| ||| | | || |
|
|
| T |
6760823 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggacccc |
6760922 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||| |
|
|
| T |
6760923 |
gcatatgcgggagctttagtgcaccgggttgccctt |
6760958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 14 - 149
Target Start/End: Original strand, 17823575 - 17823710
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||||||||||| |||| |||||||||||| ||||||| ||||||||| |||| ||| | || | |
|
|
| T |
17823575 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccct |
17823674 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
17823675 |
gcatatgcaggagctttagtgcaccgggttgccctt |
17823710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 18164896 - 18164764
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||| ||||||||| |||||||||||||| ||| | || |||| |||| | | || |
|
|
| T |
18164896 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccc |
18164798 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgcc |
146 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||| |
|
|
| T |
18164797 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
18164764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 30454232 - 30454098
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| || |||||| |||||||| |||||| |||||||||||||| ||| | | || |
|
|
| T |
30454232 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--caaggtaaggctgcgtacgatacaccaaatggtgggaccccttcccggaccc |
30454135 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
30454134 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
30454098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 138
Target Start/End: Original strand, 5689642 - 5689754
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || |||||| ||||||||||||||||| ||||||||| ||||||||||||||| ||||||||| |||| ||| | || | |||||| |||| |
|
|
| T |
5689642 |
gttcaagtcttgtaaatagcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtggga |
5689741 |
T |
 |
| Q |
126 |
gctttagtgcacc |
138 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5689742 |
gctttagtgcacc |
5689754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 138
Target Start/End: Complemental strand, 8484062 - 8483950
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || || ||||| ||||||||||||||||||||| ||| ||||||||||||||| || ||||||||||| || ||| || | ||||||||||| |
|
|
| T |
8484062 |
gttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgtatgcggga |
8483963 |
T |
 |
| Q |
126 |
gctttagtgcacc |
138 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
8483962 |
gctttagggcacc |
8483950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 26 - 149
Target Start/End: Complemental strand, 5135413 - 5135291
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || || |||||||||||||||||||||| |||||||| ||| ||||||||||| |||||||||||||| ||| | | || | ||||||| ||| |
|
|
| T |
5135413 |
gttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcagga |
5135314 |
T |
 |
| Q |
126 |
gctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||| ||||||| || ||||||| |
|
|
| T |
5135313 |
gcttt-gtgcaccgggctgccctt |
5135291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 10857852 - 10857963
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||| ||||| ||||||||| || |||||||||| ||| | |||| ||||||||||||||||||||||| |
|
|
| T |
10857852 |
aaaccgcctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcac |
10857951 |
T |
 |
| Q |
138 |
caggttgccctt |
149 |
Q |
| |
|
| |||||||||| |
|
|
| T |
10857952 |
cgggttgccctt |
10857963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 8897875 - 8897765
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||| || ||||||||||||| |||||||| || |||||||||||| |||||||||||||| ||| | | || | | ||||||||||||||| |||||| |
|
|
| T |
8897875 |
aaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacc |
8897776 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
8897775 |
cggttgccctt |
8897765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 39 - 158
Target Start/End: Original strand, 20869947 - 20870068
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | || | |||||||||||||||||||| |
|
|
| T |
20869947 |
aaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgca |
20870046 |
T |
 |
| Q |
137 |
ccaggttgcccttattgttttt |
158 |
Q |
| |
|
|| |||||||||| || ||||| |
|
|
| T |
20870047 |
ccgggttgcccttttttttttt |
20870068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 99
Target Start/End: Complemental strand, 14018106 - 14018019
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa-tggtgggacc |
99 |
Q |
| |
|
|||||||||| |||||| || || |||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
14018106 |
tgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaaattggtgggacc |
14018019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 41 - 149
Target Start/End: Original strand, 16225045 - 16225155
Alignment:
| Q |
41 |
acagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| | |||||||||| || ||| | | || | |||||||||||||||||||||| |
|
|
| T |
16225045 |
acagcctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcacc |
16225144 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
||||| |||| |
|
|
| T |
16225145 |
gggttgtcctt |
16225155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 26 - 149
Target Start/End: Complemental strand, 7136653 - 7136528
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgg |
123 |
Q |
| |
|
|||||| || || ||||| ||||||||||||||| ||||||||| ||||||||||||||| | ||||||||||||| ||| | | || | ||||||| |
|
|
| T |
7136653 |
gttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgg |
7136554 |
T |
 |
| Q |
124 |
gagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||| |||| ||||| |
|
|
| T |
7136553 |
gagctttagtgcaccgggttaccctt |
7136528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 144
Target Start/End: Complemental strand, 20284210 - 20284075
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaaca--gggtaagactgcgtacaatacactaa--atggtgggaccctttcgcag |
108 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||| ||||||| | ||||||| ||||||||||||||| || |||||||||||| ||| | | |
|
|
| T |
20284210 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgg |
20284111 |
T |
 |
| Q |
109 |
cccttacgtatgcgggagctttagtgcaccaggttg |
144 |
Q |
| |
|
|| | |||||||||||| ||||||||||| ||||| |
|
|
| T |
20284110 |
accctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 130
Target Start/End: Complemental strand, 24365171 - 24365079
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttt |
130 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||| ||||||||| |||||||||||||| ||| | | || | |||||| ||||||||| |
|
|
| T |
24365171 |
aaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtgggagcttt |
24365079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 25250523 - 25250658
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
||||||||| |||||| || || ||||||||| |||||||||||| |||||| | ||||||||||||||| | ||||||||||||| ||| | || |
|
|
| T |
25250523 |
aaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggtatggctgcgtacaatacaccaataatggtgggaccccttcccgaacccc |
25250622 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||| ||||||||||| |||||||||| |
|
|
| T |
25250623 |
gcatatgcgggagatttagtgcaccgggttgccctt |
25250658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 31457171 - 31457306
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || |||||||| ||||||||||||||| ||| ||| |||||||||||||| ||||||| |||||| ||| || || |
|
|
| T |
31457171 |
tgaaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaat-aggaaaaggctgcgtacaatacatcaaatggtaggaccccttcccaaaccc |
31457269 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||| ||||||||| | |||||||| |
|
|
| T |
31457270 |
tgcgtatgcgggagctctagtgcaccggattgccctt |
31457306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 13 - 144
Target Start/End: Complemental strand, 21070839 - 21070703
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaaca---gggtaagactgcgtacaatacactaa--atggtgggaccctttcgca |
107 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||| ||||||| | ||||||| ||||||||||||||| || |||||||||||| ||| | |
|
|
| T |
21070839 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccg |
21070740 |
T |
 |
| Q |
108 |
gcccttacgtatgcgggagctttagtgcaccaggttg |
144 |
Q |
| |
|
| || | |||||||||||| ||||||||||| ||||| |
|
|
| T |
21070739 |
gaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 44781643 - 44781517
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||| |||| |||||| || || ||||| |||||||||||||| |||||||||| ||| ||||||||||| ||||| |||||||| || ||| | |
|
|
| T |
44781643 |
tgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagac |
44781544 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
| | ||||||||||||||||||||||| |
|
|
| T |
44781543 |
cctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 50 - 147
Target Start/End: Complemental strand, 44742619 - 44742521
Alignment:
| Q |
50 |
tgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| | |||||||||||||| ||| | || |||| |||||||||| |||||||||| || ||||| |
|
|
| T |
44742619 |
tgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggggtgccc |
44742521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 14 - 138
Target Start/End: Original strand, 389642 - 389768
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgt--aaaaaacagggtaagactgcgtacaatacactaaatggtggga-ccctttcgcagcc |
110 |
Q |
| |
|
|||||||||| |||||| || || ||||| |||||||||| ||||||||||||||| |||||||||||||| ||||| ||||| ||||||| | | | |
|
|
| T |
389642 |
gaaaggtcacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttc-ctgac |
389740 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
| | |||||||| ||||||||||||||| |
|
|
| T |
389741 |
cctgcgtatgcgagagctttagtgcacc |
389768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 137
Target Start/End: Complemental strand, 17250985 - 17250888
Alignment:
| Q |
42 |
cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||||||||||||||||||| |||| | ||||||||||||| | ||||||||||||||||| | || | |||||| ||||||||||||||| |
|
|
| T |
17250985 |
cagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgcac |
17250888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 101
Target Start/End: Complemental strand, 23286432 - 23286374
Alignment:
| Q |
41 |
acagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccct |
101 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
23286432 |
acagcctcttgtgtaaaa--cagggtaaagctgcgtacaatacaccaaatggtgggaccct |
23286374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 138
Target Start/End: Complemental strand, 40605006 - 40604918
Alignment:
| Q |
49 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||||| ||| ||||| || | |||| ||||||||||||||||||||||||| |
|
|
| T |
40605006 |
ttgtgtaaaaaattggataaggttgcgtacaatacactaaatgatggatcccttccgaaaccct-acgtatgcgggagctttagtgcacc |
40604918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 39 - 100
Target Start/End: Original strand, 43942348 - 43942411
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccc |
100 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
43942348 |
aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccc |
43942411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 99
Target Start/End: Original strand, 35105921 - 35106008
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta-aatggtgggacc |
99 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||||||||||||| | || ||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
35105921 |
tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatggtgggacc |
35106008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 87 - 149
Target Start/End: Original strand, 28407475 - 28407537
Alignment:
| Q |
87 |
aaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||| ||| | | || ||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
28407475 |
aaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgccctt |
28407537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 11748297 - 11748366
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata |
82 |
Q |
| |
|
||||| ||||| |||||| || || |||||||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
11748297 |
tgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaagacagcgtacaata |
11748366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 20869633 - 20869563
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
20869633 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggctgtgtacaatacac |
20869563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 76 - 149
Target Start/End: Original strand, 26102578 - 26102651
Alignment:
| Q |
76 |
tacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
26102578 |
tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctt |
26102651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 149
Target Start/End: Original strand, 16013511 - 16013590
Alignment:
| Q |
72 |
tgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| ||| ||| || | | |||||||||||||||||||||| ||||| |||| |
|
|
| T |
16013511 |
tgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtcctt |
16013590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 137
Target Start/End: Original strand, 19729382 - 19729462
Alignment:
| Q |
57 |
aaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||||||||| ||| | | || | | ||| |||||||| |||||||| |
|
|
| T |
19729382 |
aaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcac |
19729462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 30962910 - 30962847
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgt |
76 |
Q |
| |
|
||||||||||| | ||||| || || |||||||||||||||||||||| ||||| || |||||| |
|
|
| T |
30962910 |
tgaaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaaaatagggttaggctgcgt |
30962847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 23000329 - 23000229
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||| || |||||| | | |||||||||| |||||||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
23000329 |
aaacagcctcttgtgtaaaaa-cacggtaaggttccatacaatacaccaaatggtgggaccccttc---------ccggatgcgggagctttagtgcacc |
23000240 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
23000239 |
gggttgccctt |
23000229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Complemental strand, 27468127 - 27468093
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
27468127 |
cgtatgcgggagctttagtgcaccgggttgccctt |
27468093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 13 - 90
Target Start/End: Original strand, 36918122 - 36918199
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat |
90 |
Q |
| |
|
|||||||||||| |||||| | || ||||| |||| |||||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
36918122 |
tgaaaggtcacatgttcaagttctggaaacaatttcttatgtaaaaaacagggtaaggctgtgtacaatacaccaaat |
36918199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 115 - 151
Target Start/End: Original strand, 27508010 - 27508046
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgcccttat |
151 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
27508010 |
cgtatgcgggagctttagtgcaccgggttgtccttat |
27508046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 42083836 - 42083748
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||| |||||| || || ||||||||| |||||||||||| ||| ||| ||||||||| || | | |||||||||||||| |
|
|
| T |
42083836 |
tgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaaaatggtgggaccc |
42083748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 54)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 8455450 - 8455317
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || |||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |
|
|
| T |
8455450 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
8455351 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| |
|
|
| T |
8455350 |
gtatgccggagctttagtgcaccgggttgccctt |
8455317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 26 - 149
Target Start/End: Original strand, 9671192 - 9671313
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||||||| |
|
|
| T |
9671192 |
gttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggga |
9671289 |
T |
 |
| Q |
126 |
gctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
9671290 |
gctttagtgcaccgggttgccctt |
9671313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 13 - 141
Target Start/End: Complemental strand, 32781425 - 32781298
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| ||||||| || | ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||| || |
|
|
| T |
32781425 |
tgaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccc |
32781326 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccagg |
141 |
Q |
| |
|
| ||||||||||||||| |||||||||| |
|
|
| T |
32781325 |
tgtgtatgcgggagcttt-gtgcaccagg |
32781298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 10543696 - 10543834
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || |||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | | |
|
|
| T |
10543696 |
tgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggac |
10543795 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
10543796 |
cctgcgtatgcgggagctttagtgcaccgggttgccctt |
10543834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 10546160 - 10546297
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||||||| ||||| ||||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
10546160 |
tgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacc |
10546259 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
10546260 |
ctgcgtatgcgggagctttagtgcaccgggttgccctt |
10546297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 11514437 - 11514569
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || |||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||| ||| ||| || | | |
|
|
| T |
11514437 |
aaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacaccaaatggtgggaccc-ttcccagaccctgc |
11514535 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| |
|
|
| T |
11514536 |
gtatgcgggagctttagtgcaccggattgccctt |
11514569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 14444730 - 14444862
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || |||||||||||||||||||| |||||||||| ||| |||| |||||| |||||||||||||| ||| | | || | | |
|
|
| T |
14444730 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-acagggtaaggctgtgtacgatacaccaaatggtgggaccccttcccggaccctgc |
14444828 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
14444829 |
gtatgcgggagctttagtgcaccaggttgccctt |
14444862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 14530316 - 14530454
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||| |||||||||||||||| || |||||||||||| | ||||||||||||| ||| | | | |
|
|
| T |
14530316 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggac |
14530415 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
14530416 |
cctgcgtatgcgggagctttagtgcaccgggttgccctt |
14530454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 40762345 - 40762235
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || |||||||||||| |||||||||||||||||| | || | |||||| ||||||||||||||||| |
|
|
| T |
40762345 |
aaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcacc |
40762246 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
40762245 |
gggttgccctt |
40762235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 36871517 - 36871625
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | |||||||||||||||||||||||| |
|
|
| T |
36871517 |
aaacagcctcttgtgtgaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacc-tgcgtatgcgggagctttagtgcacc |
36871614 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
36871615 |
gggttgccctt |
36871625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 50 - 149
Target Start/End: Original strand, 25632544 - 25632643
Alignment:
| Q |
50 |
tgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||||||||| | ||| | ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25632544 |
tgtgtaaaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccctt |
25632643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 21779396 - 21779262
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || | |||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
21779396 |
tgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaa--cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccc |
21779299 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
21779298 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
21779262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 23397764 - 23397898
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||| |||||| || || |||||||||||||||||||| | ||||||| || |||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
23397764 |
tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaata--gggtaaggctacgtacaatacaccaaatggtgggaccccttctcggaccc |
23397861 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
23397862 |
tacatatgcgggagctctagtgcaccgggttgccctt |
23397898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 12024055 - 12023969
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
12024055 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccc |
12023969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 104
Target Start/End: Complemental strand, 23145835 - 23145744
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttc |
104 |
Q |
| |
|
||||||||||| |||||| || || |||||| |||||||||||||||||| ||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
23145835 |
tgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttc |
23145744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 104
Target Start/End: Complemental strand, 23557625 - 23557534
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttc |
104 |
Q |
| |
|
||||||||||| |||||| || || |||||| |||||||||||||||||| ||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
23557625 |
tgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttc |
23557534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 24200762 - 24200624
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||| ||||| |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| || ||| | | | |
|
|
| T |
24200762 |
tgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggac |
24200663 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||| | ||||||||||||||| |||||||||| |
|
|
| T |
24200662 |
cctgagtatgtgagagctttagtgcaccgggttgccctt |
24200624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 16 - 158
Target Start/End: Complemental strand, 25249871 - 25249730
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || |||||| |||||||||| ||| ||||||||| ||||||||||||||| ||||||||||| || ||| | || | | |
|
|
| T |
25249871 |
aaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaa-cagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccgaaccctgc |
25249773 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgcccttattgttttt |
158 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| || ||||| |
|
|
| T |
25249772 |
gtatgcgtgagctttagtgcaccgggttgcccttttttttttt |
25249730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 30826061 - 30826169
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||| ||||||||| |||| ||| ||| || ||| |||||||||||||||||||||| |
|
|
| T |
30826061 |
aaacagcctcttgtgtaaaaat-agggtaaggttgcgtacaatacaccaaatggtggaaccc-ttcccagaccctacatatgcgggagctttagtgcacc |
30826158 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|| ||| |||| |
|
|
| T |
30826159 |
agattgtcctt |
30826169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 17668003 - 17668136
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||| | ||||||||||||||| ||||||||| ||||||||||||||| ||||||||| |||| ||| | || | | |
|
|
| T |
17668003 |
aaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcgaaccctgc |
17668102 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |
|
|
| T |
17668103 |
gtatatgggagctttagtgcaccgggttgccctt |
17668136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 19977850 - 19977715
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||||| |||||| | || |||||||||||| ||||||||| ||| |||| |||||||||||||| ||||||||||| || ||| | |||| |
|
|
| T |
19977850 |
gaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacaccaaatggtgggatcccttcccgaacctt |
19977751 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||||||||||| || ||||| |
|
|
| T |
19977750 |
gtgtatgcgggagctttagtgcaccagattaccctt |
19977715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 14544087 - 14544200
Alignment:
| Q |
39 |
aaacagcctcttgtgta-aaaaacagggtaagactgcgtacaata--cactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgc |
135 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||| || ||||||| |||||| ||| | || | ||||||||||||||||||||| |
|
|
| T |
14544087 |
aaacagcctcttgtgtagaaaaacagggtaagactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgc |
14544186 |
T |
 |
| Q |
136 |
accaggttgccctt |
149 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
14544187 |
accaagttgccctt |
14544200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 39 - 138
Target Start/End: Complemental strand, 31158552 - 31158451
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||| ||||||| || |||||||||||||| ||| ||| || | ||||||||||||||||||| || |
|
|
| T |
31158552 |
aaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtaca |
31158453 |
T |
 |
| Q |
137 |
cc |
138 |
Q |
| |
|
|| |
|
|
| T |
31158452 |
cc |
31158451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 147
Target Start/End: Complemental strand, 4516462 - 4516354
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||| || ||||||||||| ||| | | || | |||||| || |||||||||| ||| |
|
|
| T |
4516462 |
aaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtacc |
4516363 |
T |
 |
| Q |
139 |
aggttgccc |
147 |
Q |
| |
|
|| ||||| |
|
|
| T |
4516362 |
gggctgccc |
4516354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 17896283 - 17896394
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaac-agggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||| |||||||||||||||| |||||||| |||||||||||| || |||||||||||||| ||| | | || | |||||| ||||||||||||||| |
|
|
| T |
17896283 |
aaacaacctcttgtgtaaaaaaatagggtaaggctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcat |
17896382 |
T |
 |
| Q |
138 |
caggttgccctt |
149 |
Q |
| |
|
| ||||||||| |
|
|
| T |
17896383 |
cgagttgccctt |
17896394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 21377210 - 21377123
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
|||||||| || ||||||| || | ||||| ||||||||||||||||||||||||| ||| ||||||| ||| |||||||||||||| |
|
|
| T |
21377210 |
tgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaatggtgggaccc |
21377123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 25079829 - 25079718
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||| |||||||||||||||| || |||||| |||||||||||||| ||||||||||||| ||| | | || | ||||||| |||||||||||||| |
|
|
| T |
25079829 |
aaacaacctcttgtgtaaaaaaacaaggtaaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcac |
25079730 |
T |
 |
| Q |
138 |
caggttgccctt |
149 |
Q |
| |
|
| |||||||||| |
|
|
| T |
25079729 |
cgggttgccctt |
25079718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 39914417 - 39914307
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| || ||||||||||| ||||||||||||| ||| | | || | |||||||||||||||||||||| |
|
|
| T |
39914417 |
aaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccgaatggtgggaccccttc-ctgaccctgcgtatgcgggagctttagtgcat |
39914319 |
T |
 |
| Q |
138 |
caggttgccctt |
149 |
Q |
| |
|
| |||||||||| |
|
|
| T |
39914318 |
cgggttgccctt |
39914307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 134
Target Start/End: Complemental strand, 99400 - 99281
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || | |||||||||||||| |||||||| || ||| ||||||||||||||| ||||||||| |||| ||| ||| || |
|
|
| T |
99400 |
tgaaaggtcacgggttcaagtcctagaaacagcctcttgt--aaaaaacatggcaaggctgcgtacaatacaccaaatggtggaaccccttctcagaccc |
99303 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtg |
134 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
99302 |
tgtgtatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 17623588 - 17623698
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| ||||||||||||||| ||||||||| |||| ||| | | | |||||| || ||||||||||||| |
|
|
| T |
17623588 |
aaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcact |
17623687 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
17623688 |
gggttgccctt |
17623698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 55 - 149
Target Start/End: Original strand, 44643563 - 44643657
Alignment:
| Q |
55 |
aaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||| ||||| ||||||||||| || |||||||||||||| ||| ||| || | ||||||||||||| |||||||||| || ||||||| |
|
|
| T |
44643563 |
aaaaaacagagtaaggctgcgtacaatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctt |
44643657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 40 - 149
Target Start/End: Original strand, 27573646 - 27573754
Alignment:
| Q |
40 |
aacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacca |
139 |
Q |
| |
|
|||||||||||||||| ||| || |||||| ||||||||||||||| ||||||||| ||| |||| || || | ||||| ||||||||||||||| | |
|
|
| T |
27573646 |
aacagcctcttgtgtataaa-catggtaaggctgcgtacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcg |
27573744 |
T |
 |
| Q |
140 |
ggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
27573745 |
ggttgccctt |
27573754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 40417005 - 40416872
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||||| |||||||| |||||||||||| ||| ||| ||||||||||| || || ||||||||||| | || | | |
|
|
| T |
40417005 |
aaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaattgatgggacccttttttggaccctgc |
40416906 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||| |
|
|
| T |
40416905 |
atatgcgagagctttagtgcaccgggttgccctt |
40416872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 100
Target Start/End: Original strand, 5450283 - 5450371
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||||||||||||||| || |||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
5450283 |
tgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagggtgggaccc |
5450371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 7214532 - 7214667
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||||||| |||||| || || |||||| ||||||||||||| |||||||||| ||||||||||||||| |||||||| || || ||| | | | |
|
|
| T |
7214532 |
tgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgagatcccttctcggac |
7214631 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgcc |
146 |
Q |
| |
|
| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
7214632 |
actgcgtatgcgagagttttagtgcaccaggttgcc |
7214667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 13 - 147
Target Start/End: Complemental strand, 45235955 - 45235820
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
|||||| |||| ||||||| || | |||||| ||||| ||||||| || |||||||| || ||| ||||||| |||||||||||||| || ||| || |
|
|
| T |
45235955 |
tgaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataatagggtaaggctacgtgtaatacacaaaatggtgggaccccttaccagacc |
45235856 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
45235855 |
ctacgtatgcaggagctttagtgtaccaagttgccc |
45235820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 44521510 - 44521392
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| ||||||||| || ||||| ||||||||||||||||| |||||| |||| || ||||||| |||||| |||| || ||| ||| | | |
|
|
| T |
44521510 |
tgaaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaatggcgggagcccttcccagacat |
44521411 |
T |
 |
| Q |
113 |
tacgtatgcgggagcttta |
131 |
Q |
| |
|
| | ||| ||||||||||| |
|
|
| T |
44521410 |
tgcatatacgggagcttta |
44521392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 5841052 - 5841164
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||||||||||||| | ||||||||||||| ||| | | || | |||||||||||||||||||| |
|
|
| T |
5841052 |
aaacagccttttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca |
5841151 |
T |
 |
| Q |
137 |
ccaggttgccctt |
149 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
5841152 |
ccgagttgccctt |
5841164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 19614990 - 19615059
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata |
82 |
Q |
| |
|
||||||||||| |||||| || | ||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19614990 |
tgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaata |
19615059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 100
Target Start/End: Original strand, 22371059 - 22371139
Alignment:
| Q |
17 |
aggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||| |||||| || || |||||||||| ||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
22371059 |
aggtcacgggttcaagtcctggaaacagcctcgtgt---aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccc |
22371139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 14 - 90
Target Start/End: Complemental strand, 12315787 - 12315712
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat |
90 |
Q |
| |
|
|||||||||| ||||||| || || ||||||| |||| | |||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
12315787 |
gaaaggtcacgagttcaagtcatggaaacagcttcttat-taaaaaacagggtaagactgtgtacaatacaccaaat |
12315712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 29420026 - 29419970
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaag |
69 |
Q |
| |
|
||||||||||| ||||||| || || ||||| ||||||||||||||||||||||||| |
|
|
| T |
29420026 |
tgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaag |
29419970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 26684759 - 26684632
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacag-cctcttgtgtaaaaaac-agggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||||||| | ||| || || || |||||| |||||||||||||||| | |||||| |||||||||||| |||||||||||||||| ||| | | |
|
|
| T |
26684759 |
tgaaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggtaaggctgcgtacaatatactaaatggtgggacctcttcccgaac |
26684660 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
| | ||||||||||||||||| |||||| |
|
|
| T |
26684659 |
cctgcgtatgcgggagctttaatgcacc |
26684632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 55 - 137
Target Start/End: Original strand, 24890451 - 24890533
Alignment:
| Q |
55 |
aaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
|||||||| |||||| |||| |||||||||| || ||||||||||| ||| | | || | ||||||| ||||||||||||||| |
|
|
| T |
24890451 |
aaaaaacaaggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 130
Target Start/End: Original strand, 33795283 - 33795400
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtac-aatacactaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
||||||||||| |||||| || | ||||| ||||||| ||||||||||||||||| |||||||| ||||||| |||||||||||| ||| ||| || |
|
|
| T |
33795283 |
tgaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacac-ctatggtgggaccccttcccagacc |
33795381 |
T |
 |
| Q |
112 |
ttacgtatgcgggagcttt |
130 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
33795382 |
ctgtgtatgcgggagcttt |
33795400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 64 - 149
Target Start/End: Complemental strand, 13245181 - 13245096
Alignment:
| Q |
64 |
ggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| ||| | | || | | ||| |||||||||||||| | | |||||||||| |
|
|
| T |
13245181 |
ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt |
13245096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 39 - 138
Target Start/End: Original strand, 17471572 - 17471673
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||| | | ||||| || ||||| ||| | | || | | |||||||||| ||||||||| |
|
|
| T |
17471572 |
aaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgca |
17471671 |
T |
 |
| Q |
137 |
cc |
138 |
Q |
| |
|
|| |
|
|
| T |
17471672 |
cc |
17471673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 31821478 - 31821393
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||| ||||||||||| |||||||| || ||||||||||| ||||| |||||||| |
|
|
| T |
31821478 |
tgaaaggtcacgagttcaagtcgtagaaacagccg--tgtgtaaaaaatagggtaaggttgtgtacaatacaccaaatgatgggaccc |
31821393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 152
Target Start/End: Complemental strand, 40579783 - 40579747
Alignment:
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgcccttatt |
152 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40579783 |
gtatgcgggagctttagtgcaccgggttgcccttatt |
40579747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 82
Target Start/End: Complemental strand, 15296518 - 15296475
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata |
82 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
15296518 |
aaacagcctgttgtgtaaaatacagggtaaggctgcgtacaata |
15296475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 71 - 138
Target Start/End: Complemental strand, 24860067 - 24860000
Alignment:
| Q |
71 |
ctgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||| ||||||| | |||| ||| | | || | |||||||||||||||||||||||| |
|
|
| T |
24860067 |
ctgcgtacaatacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcacc |
24860000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Original strand, 8575995 - 8576029
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
8575995 |
cgtatgtgggagctttagtgcaccaggttgccctt |
8576029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Original strand, 22371212 - 22371246
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
22371212 |
cgtatgcgggagctttagtgcaccgggttgccctt |
22371246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 85
Target Start/End: Original strand, 17705496 - 17705565
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
|||||||| |||||| || || |||| |||||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
17705496 |
aaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaaggctgtgtacaatacac |
17705565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 58975 - 59113
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||| | |
|
|
| T |
58975 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagac |
59074 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||| | |||||||||| |
|
|
| T |
59075 |
tctgcgtatgcgggagctttagtgcatcgggttgccctt |
59113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 37)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 29355994 - 29355856
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||| |||||||||||| ||||||||||||||| | ||||||||||||| ||| | | | |
|
|
| T |
29355994 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggac |
29355895 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
29355894 |
cctgcgtatgcgggagctttagtgcaccgggttgccctt |
29355856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 12222054 - 12221915
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | | |
|
|
| T |
12222054 |
tgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggac |
12221955 |
T |
 |
| Q |
111 |
cttacgtatgcgggagc-tttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
12221954 |
cctgcgtatgcgggagcttttagtgcaccgggttgccctt |
12221915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 1354892 - 1354758
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
1354892 |
tgaaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
1354795 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
1354794 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
1354758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 9161121 - 9161258
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa--atggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||||||||| |||||| || || ||||||||||||||||||||| ||| ||||| |||||||||||||| || |||||||||||| ||| | | | |
|
|
| T |
9161121 |
tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaa-cagagtaaggctgcgtacaatacatcaataatggtgggaccccttctcggac |
9161219 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9161220 |
cctgcgtatgcggaagctttagtgcaccaggttgccctt |
9161258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 1346962 - 1347096
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||| ||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
1346962 |
tgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
1347059 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
1347060 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
1347096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 32728293 - 32728158
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| ||||| | || ||||| |||||| |||||||||||||||||||||| |||||||| || |||| || || ||||||| ||| || |
|
|
| T |
32728293 |
tgaaaggtcacagattcaagttttggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaatagt-ggtccctttcccagaccc |
32728195 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
32728194 |
tacgtatgcgggaactttagtgcaccatgttgccctt |
32728158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 13 - 143
Target Start/End: Complemental strand, 3815214 - 3815084
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||| ||||| |||||| || || |||||| || |||||||||||| | |||| ||||||||||||||||| |||||||||||||||||| | || |
|
|
| T |
3815214 |
tgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacgactgcgtacaatacaccaaatggtgggaccctttcccgaaccc |
3815115 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggtt |
143 |
Q |
| |
|
||||||||||| |||||||||||||| |||| |
|
|
| T |
3815114 |
tacgtatgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 149
Target Start/End: Complemental strand, 18277328 - 18277194
Alignment:
| Q |
15 |
aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctta |
114 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||||||| ||||||||| || ||||| |||| |||||||||||||| ||| || | || |
|
|
| T |
18277328 |
aaaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggaccccttcctagactcta |
18277229 |
T |
 |
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||| |
|
|
| T |
18277228 |
cgtatgcgggagctttactgcaccgggttgtcctt |
18277194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 13 - 103
Target Start/End: Original strand, 20400665 - 20400755
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacccttt |
103 |
Q |
| |
|
|||||||||||| |||||| | || ||||| |||||||||||||||||||||||||||||||||| |||||||||| | |||||||||| |
|
|
| T |
20400665 |
tgaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaagactgcgtacagtacactaaatagcgggacccttt |
20400755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 7947509 - 7947384
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||| |||||||||| ||||||||| |||||||||||||| | |||||||||| ||| ||| | | || |
|
|
| T |
7947509 |
tgaaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggacc |
7947410 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
|| |||||| |||||||||||||||| |
|
|
| T |
7947409 |
ttgcgtatgtgggagctttagtgcac |
7947384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 36 - 100
Target Start/End: Original strand, 1941876 - 1941940
Alignment:
| Q |
36 |
tgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
1941876 |
tgtaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccc |
1941940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 2166549 - 2166411
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||||||||||||| ||||| |||| |||||||||||||| | ||||||||||||| ||| | | | |
|
|
| T |
2166549 |
tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggac |
2166450 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| || ||| |||||||||||||||||| |||||||||| |
|
|
| T |
2166449 |
cctatatattcgggagctttagtgcaccgggttgccctt |
2166411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 2178182 - 2178044
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||||||||||||| ||||| |||| |||||||||||||| | ||||||||||||| ||| | | | |
|
|
| T |
2178182 |
tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggac |
2178083 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| || ||| |||||||||||||||||| |||||||||| |
|
|
| T |
2178082 |
cctatatattcgggagctttagtgcaccgggttgccctt |
2178044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 26097184 - 26097292
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||| ||||| ||||||| ||| | | || | | |||||||||||| ||||||||| |
|
|
| T |
26097184 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
26097281 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
26097282 |
gggttgccctt |
26097292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 25557749 - 25557857
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||| ||||| || |||| ||| | | || | | |||||||||||| ||||||||| |
|
|
| T |
25557749 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtgcacc |
25557846 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
25557847 |
gggttgccctt |
25557857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 39 - 85
Target Start/End: Original strand, 6024257 - 6024303
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6024257 |
aaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacac |
6024303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 23240959 - 23240837
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| || ||| || || |||||||||||||||| ||||||||||||| ||||||||||| || || ||||||||||| ||| | | |
|
|
| T |
23240959 |
tgaaaggtcacaggtgcaagtcctggaaacagcctcttgtgt--aaaacagggtaagtttgcgtacaatataccaattggtgggaccccttctaggacaa |
23240862 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
23240861 |
tgcgtatgcgggagctttagtgcac |
23240837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 26 - 103
Target Start/End: Original strand, 33138844 - 33138921
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacccttt |
103 |
Q |
| |
|
|||||| || || ||||| |||||||| |||||||||| ||||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
33138844 |
gttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttt |
33138921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 12889424 - 12889496
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
|||||||||||| |||||| || || |||||||||||||||| |||||||||| ||| |||| |||||||||| |
|
|
| T |
12889424 |
tgaaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacac |
12889496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 24097579 - 24097711
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||| || || | || ||||||||||| |||||||||||||||| |||| |||| || |||||||||||||| ||| | | || |
|
|
| T |
24097579 |
tgaaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttaca----accaaatggtgggaccccttcccggaccc |
24097674 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
24097675 |
tgcgtatgcggaagctttagtgtcccaggttgccctt |
24097711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 13 - 83
Target Start/End: Original strand, 8409241 - 8409311
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatac |
83 |
Q |
| |
|
||||||||||| ||||| || || |||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8409241 |
tgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggtaaggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 149
Target Start/End: Original strand, 12885967 - 12886047
Alignment:
| Q |
71 |
ctgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| ||| ||| || | |||||| ||||||||||||||||| |||||||||| |
|
|
| T |
12885967 |
ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctt |
12886047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 89
Target Start/End: Complemental strand, 24751176 - 24751135
Alignment:
| Q |
48 |
cttgtgtaaaaaacagggtaagactgcgtacaatacactaaa |
89 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24751176 |
cttgtgtaaaaaatagggtaagactgcgtacaatacactaaa |
24751135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 143
Target Start/End: Original strand, 32579437 - 32579553
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || || ||||||||||| || |||||| | |||||| ||||||||||||| | |||||||||||||| ||| ||| || | | ||||||||| |
|
|
| T |
32579437 |
gttcaagtcctggaaacagcctctggtataaaaat-acggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcggga |
32579535 |
T |
 |
| Q |
126 |
gctttagtgcaccaggtt |
143 |
Q |
| |
|
|||||||| | ||||||| |
|
|
| T |
32579536 |
gctttagtactccaggtt |
32579553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 73 - 149
Target Start/End: Complemental strand, 383837 - 383761
Alignment:
| Q |
73 |
gcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||| ||| || | ||||||||||||||| ||| |||| |||||||||| |
|
|
| T |
383837 |
gcgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgccctt |
383761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 15 - 128
Target Start/End: Original strand, 14553511 - 14553626
Alignment:
| Q |
15 |
aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa--tggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||| |||||| || || ||| ||| |||||||||||||| |||||||| ||| ||| ||||||| ||| ||||||||||| |||| || || |
|
|
| T |
14553511 |
aaaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtataatacaccaaaactggtgggaccccttcgtagaccc |
14553610 |
T |
 |
| Q |
113 |
tacgtatgcgggagct |
128 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
14553611 |
tgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 104
Target Start/End: Complemental strand, 13905116 - 13905026
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttc |
104 |
Q |
| |
|
||||||||||| | |||| || || |||| ||||||||||||||||||||||||| |||| |||||| ||| ||||||| |||||||||| |
|
|
| T |
13905116 |
tgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaaggctgcatacaattcaccaaatggt-ggaccctttc |
13905026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 17432338 - 17432482
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaac------agggtaagactgcgtacaatacact--aaatggtgggaccctttc |
104 |
Q |
| |
|
|||||||||||| |||||| || || ||||| | ||||||||||||||| |||||||| ||| |||||||||||| |||||||| |||| |||| |
|
|
| T |
17432338 |
tgaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagggtaaggctgtgtacaatacactaaaaatggtgagaccttttc |
17432437 |
T |
 |
| Q |
105 |
gcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | | | | ||||||||||||||||||||| |||||||||| |
|
|
| T |
17432438 |
ccggatcctgtgcatgcgggagctttagtgcaccgggttgccctt |
17432482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 28007628 - 28007711
Alignment:
| Q |
15 |
aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||| |||||| || || ||| |||||||||||||||| |||||| || ||||||||||||||| ||||| |||||||| |
|
|
| T |
28007628 |
aaaggtcacgggttcaagtcctggaaagagcctcttgtgtaaaa--cagggtcaggctgcgtacaatacaccaaatgctgggaccc |
28007711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 15866174 - 15866052
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||| |||||| || || |||||||||||| |||||||||||||||| |||||| ||||||| |||||||||||||| ||| | | || |
|
|
| T |
15866174 |
tgaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggtaaagctgcgt--aatacaccaaatggtgggaccccttcccggaccc |
15866077 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
| ||| ||||||| || |||||||| |
|
|
| T |
15866076 |
tgcgtttgcgggatctatagtgcac |
15866052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 72 - 149
Target Start/End: Complemental strand, 23930205 - 23930128
Alignment:
| Q |
72 |
tgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||| | | || | | |||||||||||||||||||||| ||||||||| |
|
|
| T |
23930205 |
tgcgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctt |
23930128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 158
Target Start/End: Complemental strand, 3116212 - 3116121
Alignment:
| Q |
69 |
gactgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgttttt |
158 |
Q |
| |
|
||||||| ||||||||| ||| ||||||||||| ||| | | |||| ||||||||||||||||||| |||| | |||||||| || ||||| |
|
|
| T |
3116212 |
gactgcgcacaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcccttttttttttt |
3116121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 74
Target Start/End: Complemental strand, 9671196 - 9671161
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgc |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9671196 |
aaacagcctcttgtgtaaaaaacagggtaaggctgc |
9671161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 78 - 149
Target Start/End: Original strand, 13267788 - 13267859
Alignment:
| Q |
78 |
caatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||| |||||||||||||| ||| | || | ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
13267788 |
caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccctt |
13267859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 158
Target Start/End: Original strand, 6808496 - 6808538
Alignment:
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgcccttattgttttt |
158 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
6808496 |
gtatgcgggagctttagtgcaccgggttgccctttttcttttt |
6808538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 149
Target Start/End: Original strand, 12892111 - 12892143
Alignment:
| Q |
117 |
tatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
12892111 |
tatgcgggagctttagtgcaccgggttgccctt |
12892143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 90
Target Start/End: Complemental strand, 13628368 - 13628316
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaat |
90 |
Q |
| |
|
|||||||||||||| ||||||| || ||||| | ||||||||||||||||||| |
|
|
| T |
13628368 |
aaacagcctcttgtttaaaaaaacaaggtaaaattgcgtacaatacactaaat |
13628316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 44)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 16 - 159
Target Start/End: Original strand, 24448891 - 24449034
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||||||||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |
|
|
| T |
24448891 |
aaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
24448990 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgcccttattgttttta |
159 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| || |||||| |
|
|
| T |
24448991 |
gtatgcaggagctttagtgcaccgggttgcccttttttttttta |
24449034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 38879579 - 38879717
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||| |||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | | |
|
|
| T |
38879579 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggac |
38879678 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
38879679 |
cctgcgtatgcgggagctttagtgcaccgggttgccctt |
38879717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 40 - 149
Target Start/End: Complemental strand, 16880757 - 16880648
Alignment:
| Q |
40 |
aacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacca |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| ||| | | || | |||||||||||||||||||||||| |
|
|
| T |
16880757 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg |
16880658 |
T |
 |
| Q |
140 |
ggttgccctt |
149 |
Q |
| |
|
|||| ||||| |
|
|
| T |
16880657 |
ggtttccctt |
16880648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 32703422 - 32703556
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
32703422 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
32703519 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
32703520 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
32703556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 28516571 - 28516434
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||||||||||||||||||| || | |||||||||||||| | |||||||||||||| ||| ||| || |
|
|
| T |
28516571 |
tgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaatggtgggacccattcccagacc |
28516472 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| || |||| |||||||||||| |||||||||||||| |
|
|
| T |
28516471 |
ctgcgcatgcaggagctttagtggaccaggttgccctt |
28516434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 41014320 - 41014452
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || |||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| ||| | || | |
|
|
| T |
41014320 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgc |
41014418 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
41014419 |
atatgcgggagctttagtgcaccgggttgccctt |
41014452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 13 - 136
Target Start/End: Original strand, 27328750 - 27328875
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
|||||||||||| |||||| || || |||||| |||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | |
|
|
| T |
27328750 |
tgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaac |
27328849 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
| | ||||||||||||||||| |||| |
|
|
| T |
27328850 |
cctgcgtatgcgggagctttaatgca |
27328875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 4619240 - 4619105
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||| |||||| || || ||| ||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | || |
|
|
| T |
4619240 |
aaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
4619141 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||| ||||||||||||||| |||||||||| |
|
|
| T |
4619140 |
gcatatgcgagagctttagtgcaccgggttgccctt |
4619105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 8170118 - 8169985
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||||| |||||| || || ||||||||| |||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | |
|
|
| T |
8170118 |
gaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
8170021 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||| || |||||||| |||||||||| |
|
|
| T |
8170020 |
gcatatgcgggagtttcagtgcaccgggttgccctt |
8169985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 43334200 - 43334338
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaa--tggtgggaccctttcgcagc |
109 |
Q |
| |
|
||||||||||| |||||| || || |||||||||| ||||||||||| ||||||||| ||||||||||||||| ||| ||||||||||| ||| | | |
|
|
| T |
43334200 |
tgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccgga |
43334299 |
T |
 |
| Q |
110 |
ccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|| | || ||||||||||||||||||||| |||||||||| |
|
|
| T |
43334300 |
ccctgcg-atgcgggagctttagtgcaccgggttgccctt |
43334338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 7097870 - 7097761
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||| |||||||| ||||| ||| | || | |||||||||||||||||||||||| |
|
|
| T |
7097870 |
aaacagcctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc |
7097772 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
| | ||||||| |
|
|
| T |
7097771 |
atgctgccctt |
7097761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 42 - 149
Target Start/End: Complemental strand, 13801877 - 13801768
Alignment:
| Q |
42 |
cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacca |
139 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| ||| | | || | |||||| ||||||||||||||| |
|
|
| T |
13801877 |
cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccg |
13801778 |
T |
 |
| Q |
140 |
ggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
13801777 |
ggttgccctt |
13801768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 35710311 - 35710445
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| | ||||||| |||||| |||||||| |||||||||||||| ||| | | | |
|
|
| T |
35710311 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaata--gggtaaggctgcgttcaatacaccaaatggtgggaccccttcccggaaca |
35710408 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
35710409 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
35710445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 21 - 137
Target Start/End: Complemental strand, 19143071 - 19142956
Alignment:
| Q |
21 |
cacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatg |
120 |
Q |
| |
|
|||| |||||| || || ||||| ||||||||||||||| ||||||||| ||||||||| ||||| |||||||||||||| ||| | | || | |||||| |
|
|
| T |
19143071 |
cacaggttcaagtcctggaaacaacctcttgtgtaaaaa-cagggtaaggctgcgtacagtacaccaaatggtgggaccccttcccggaccatgcgtatg |
19142973 |
T |
 |
| Q |
121 |
cgggagctttagtgcac |
137 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
19142972 |
cgggagatttagtgcac |
19142956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 46 - 138
Target Start/End: Original strand, 43574637 - 43574729
Alignment:
| Q |
46 |
ctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| || |||||||||||||| ||| | | || | |||||||||||||||||| ||||| |
|
|
| T |
43574637 |
ctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagcacc |
43574729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 29334419 - 29334530
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta-aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||| | ||||||||||||| ||| | | || | |||||| |||| ||||| ||||| |
|
|
| T |
29334419 |
aaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcac |
29334518 |
T |
 |
| Q |
138 |
caggttgccctt |
149 |
Q |
| |
|
| || ||||||| |
|
|
| T |
29334519 |
cgggctgccctt |
29334530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 39 - 146
Target Start/End: Original strand, 30006349 - 30006456
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||| |||||| | |||| ||||||||||| ||| ||||| |||||||||||||||||||| ||| | | | || ||||||||||||||||||||||| |
|
|
| T |
30006349 |
aaacaacctcttatataaacaacagggtaaggctgtgtacattacactaaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcacc |
30006448 |
T |
 |
| Q |
139 |
aggttgcc |
146 |
Q |
| |
|
||||||| |
|
|
| T |
30006449 |
gggttgcc |
30006456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 39 - 147
Target Start/End: Original strand, 7368422 - 7368528
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||| || ||||||||||| ||| | | || | | |||| ||||||| ||||||||| |
|
|
| T |
7368422 |
aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctctagtgcacc |
7368519 |
T |
 |
| Q |
139 |
aggttgccc |
147 |
Q |
| |
|
|||||||| |
|
|
| T |
7368520 |
gggttgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 20135628 - 20135740
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||| | ||||||||||||| ||| | | || | ||||| ||||||| |||||| |
|
|
| T |
20135628 |
aaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgca |
20135727 |
T |
 |
| Q |
137 |
ccaggttgccctt |
149 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
20135728 |
ccgggttgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 22187283 - 22187421
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| ||| || || || |||||||||||||||||||||||| | |||||||||||||||||||| ||| || ||||| ||| || | |
|
|
| T |
22187283 |
tgaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgataagactgcgtacaatacaccaaaaacaatgagaccccttcccaaac |
22187382 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||| ||||| |||||||||||||| |||||||||||| |
|
|
| T |
22187383 |
cctacatatgcaggagctttagtgcatcaggttgccctt |
22187421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 39 - 150
Target Start/End: Complemental strand, 12006441 - 12006328
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa--atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
||||| |||||| ||||||||| |||||||| || | |||||||||| || |||||||||||| ||| ||| || | | |||||||||||||||||||| |
|
|
| T |
12006441 |
aaacaacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgca |
12006342 |
T |
 |
| Q |
137 |
ccaggttgccctta |
150 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
12006341 |
ccgtgttgccctta |
12006328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 75 - 149
Target Start/End: Original strand, 16957374 - 16957448
Alignment:
| Q |
75 |
gtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||| |||||||||||||| ||| | | || | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
16957374 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
16957448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 39 - 127
Target Start/End: Original strand, 2838803 - 2838890
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagc |
127 |
Q |
| |
|
||||||| |||||||||||| |||||||||| ||||||||||||||| ||||||||||| || ||| | | || | ||||||||||||| |
|
|
| T |
2838803 |
aaacagcatcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagc |
2838890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 61 - 149
Target Start/End: Complemental strand, 34154903 - 34154815
Alignment:
| Q |
61 |
cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | ||||||| |||| ||||||||| |||||||||| |
|
|
| T |
34154903 |
cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgccctt |
34154815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 42924971 - 42924899
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
||||||||||| ||||||| || || ||||| | ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42924971 |
tgaaaggtcacgagttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacac |
42924899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 13 - 92
Target Start/End: Complemental strand, 34074699 - 34074620
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatgg |
92 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||||||||| ||||| ||||| |||||||| |||||| |
|
|
| T |
34074699 |
tgaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatgg |
34074620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 16 - 104
Target Start/End: Original strand, 1405188 - 1405276
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttc |
104 |
Q |
| |
|
|||||||| |||||| || || ||||| |||||| | ||||||| || ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
1405188 |
aaggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtgggaccctttc |
1405276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 90 - 146
Target Start/End: Original strand, 39801591 - 39801647
Alignment:
| Q |
90 |
tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc |
146 |
Q |
| |
|
||||||||||| ||| ||| || |||||||||||||||||||||||||| ||||||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc |
39801647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 99
Target Start/End: Original strand, 36770806 - 36770864
Alignment:
| Q |
40 |
aacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacc |
99 |
Q |
| |
|
||||||||||| ||||||||||| |||||| | || |||||||||||||||||||||||| |
|
|
| T |
36770806 |
aacagcctcttatgtaaaaaacaaggtaagcc-gcatacaatacactaaatggtgggacc |
36770864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 100
Target Start/End: Original strand, 41425982 - 41426033
Alignment:
| Q |
49 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| || ||||||||||| |
|
|
| T |
41425982 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccc |
41426033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 209062 - 208977
Alignment:
| Q |
15 |
aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||||||||| || || |||| ||||||||||| ||||||||||||| |||| | ||||||| | |||||||||||||| |
|
|
| T |
209062 |
aaaggtcacaagttcaagtcctggcaacaacctcttgtgta-aaaacagggtaaggctgcattcaatacaccaaaatggtgggaccc |
208977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 130
Target Start/End: Original strand, 22600488 - 22600569
Alignment:
| Q |
49 |
ttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttt |
130 |
Q |
| |
|
|||||||||| |||||||||| ||| ||||||||||| ||||||||||| || ||| | | | | |||||||||||||||| |
|
|
| T |
22600488 |
ttgtgtaaaacacagggtaaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 39 - 100
Target Start/End: Complemental strand, 22907975 - 22907915
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
22907975 |
aaacagcctcttgtgtaaaaa-cagagtaaggttgcatacaatacaccaaatggtgggaccc |
22907915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 115 - 156
Target Start/End: Complemental strand, 29184096 - 29184055
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgcccttattgttt |
156 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
29184096 |
cgtatgcgggagctttagtgcaccgggttgcccttatagttt |
29184055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 22025541 - 22025597
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaag |
69 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||||||||||||||||||||| |
|
|
| T |
22025541 |
tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaag |
22025597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 37024691 - 37024626
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaa |
80 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
37024691 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaa |
37024626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 130
Target Start/End: Complemental strand, 24323816 - 24323725
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttt |
130 |
Q |
| |
|
||||| |||||||||||||| |||||||||| |||||| ||||| | |||| ||||||||| ||| ||| || | |||||||||||||| |
|
|
| T |
24323816 |
aaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcgggagcttt |
24323725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 130
Target Start/End: Complemental strand, 24360440 - 24360349
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttt |
130 |
Q |
| |
|
||||| |||||||||||||| |||||||||| |||||| ||||| | |||| ||||||||| ||| ||| || | |||||||||||||| |
|
|
| T |
24360440 |
aaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcgggagcttt |
24360349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 151
Target Start/End: Original strand, 19438768 - 19438802
Alignment:
| Q |
117 |
tatgcgggagctttagtgcaccaggttgcccttat |
151 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
19438768 |
tatgcgggagctctagtgcaccaggttgcccttat |
19438802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 149
Target Start/End: Complemental strand, 31694207 - 31694109
Alignment:
| Q |
51 |
gtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||| ||| ||| |||| |||||||||| | || |||||| | ||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
31694207 |
gtgtaaaaaataggctaaagctgcatacaatacacctattgatgggactccttcccagaccttgcgtatgcgggagatttagtgcaccagactgccctt |
31694109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 57 - 138
Target Start/End: Complemental strand, 9794471 - 9794390
Alignment:
| Q |
57 |
aaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| |||||| || ||| ||| || | ||||| | |||||||||||||| |
|
|
| T |
9794471 |
aaaacagggtaagactgcatacaatacaccaaatagtgggatcccttcacagacccagcatatgcagaagctttagtgcacc |
9794390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 39 - 100
Target Start/End: Complemental strand, 24903807 - 24903746
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| || ||||||| ||| || ||||| ||||| |
|
|
| T |
24903807 |
aaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaattggtgagaccc |
24903746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 88 - 149
Target Start/End: Original strand, 25622533 - 25622594
Alignment:
| Q |
88 |
aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||| ||| | | || | |||||||||||||||||||||||| | |||||||| |
|
|
| T |
25622533 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctt |
25622594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 116 - 149
Target Start/End: Original strand, 32354228 - 32354261
Alignment:
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
32354228 |
gtatgcgggagctttagtgcaccgggttgccctt |
32354261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 73)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 39 - 149
Target Start/End: Complemental strand, 20639770 - 20639659
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||| ||| | | || | ||||||||||||||||||||||| |
|
|
| T |
20639770 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
20639671 |
T |
 |
| Q |
138 |
caggttgccctt |
149 |
Q |
| |
|
| |||||||||| |
|
|
| T |
20639670 |
cgggttgccctt |
20639659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 13 - 151
Target Start/End: Complemental strand, 6430762 - 6430625
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||| ||| | | || |
|
|
| T |
6430762 |
tgaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccacttcccggaccc |
6430664 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgcccttat |
151 |
Q |
| |
|
| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
6430663 |
tgcgtatgcgggagctttagcgcaccgggttgcccttat |
6430625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 13 - 147
Target Start/End: Complemental strand, 17043531 - 17043398
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || || |||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| ||| ||| || |
|
|
| T |
17043531 |
tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccc |
17043432 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
| | ||||| ||||||||| ||||||||| ||||| |
|
|
| T |
17043431 |
tgcatatgctggagcttta-tgcaccaggctgccc |
17043398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 14983858 - 14983968
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| ||| | | || | |||||||||||||||||||| ||| |
|
|
| T |
14983858 |
aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtacc |
14983957 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
| ||||||||| |
|
|
| T |
14983958 |
atgttgccctt |
14983968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 25629073 - 25629183
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| ||||||||||| |||||||||||||| ||| | | || ||| |||||||||||||||||||||| |
|
|
| T |
25629073 |
aaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcacc |
25629172 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
25629173 |
gggttgccctt |
25629183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 16 - 149
Target Start/End: Original strand, 5648260 - 5648392
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || |||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |
|
|
| T |
5648260 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
5648358 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| |
|
|
| T |
5648359 |
gtatgcgggagcttcagtgcactgggttgccctt |
5648392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 16 - 149
Target Start/End: Complemental strand, 16408737 - 16408602
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||| ||| | | || |
|
|
| T |
16408737 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggacccc |
16408638 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||| |
|
|
| T |
16408637 |
gcatatgcgggagctttagtgcaccgggttgccctt |
16408602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 44363269 - 44363131
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc |
110 |
Q |
| |
|
||||||||||| ||||||| || || |||||||||| |||||||||||||||||| | |||||||||| ||| |||||||||||||| ||| | | | |
|
|
| T |
44363269 |
tgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggac |
44363170 |
T |
 |
| Q |
111 |
cttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
44363169 |
cctgcgtatgcgggagctttagtgcaccgggttgccctt |
44363131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 149
Target Start/End: Original strand, 47443956 - 47444091
Alignment:
| Q |
14 |
gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | |
|
|
| T |
47443956 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
47444055 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||||| ||||||| ||||||| |||||||||| |
|
|
| T |
47444056 |
gcatatgcaggagcttcagtgcactgggttgccctt |
47444091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 147
Target Start/End: Original strand, 21646965 - 21647098
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagccctt |
113 |
Q |
| |
|
||||||||| |||||| || || |||||||||||||||||||||| |||||||| |||||||||||| || | ||||||||||||| ||| ||| || |
|
|
| T |
21646965 |
aaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatataccaataatggtgggaccccttcccagacccc |
21647064 |
T |
 |
| Q |
114 |
acgtatgcgggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
| |||||||||||||||||||||| |||||||| |
|
|
| T |
21647065 |
gcatatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 36 - 138
Target Start/End: Complemental strand, 51865152 - 51865050
Alignment:
| Q |
36 |
tgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgc |
135 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||| ||| ||| | | || | ||||||||||||||||| ||| |
|
|
| T |
51865152 |
tgtaaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgc |
51865053 |
T |
 |
| Q |
136 |
acc |
138 |
Q |
| |
|
||| |
|
|
| T |
51865052 |
acc |
51865050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 47528665 - 47528531
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| || || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
47528665 |
tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
47528568 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||| ||||||| ||||||||| |||||||||| |
|
|
| T |
47528567 |
tgaatatgtgggagctctagtgcaccgggttgccctt |
47528531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 48598960 - 48598826
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
48598960 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacca |
48598863 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||| |||||| ||||||||| |||||||||| |
|
|
| T |
48598862 |
tgcatatgccggagctctagtgcaccgggttgccctt |
48598826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 30639378 - 30639513
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||| ||||||||||||| |||||||||| ||||||||||||||| |||||||| ||||| ||| | | || |
|
|
| T |
30639378 |
tgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgagaccccttcccggaccc |
30639476 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||||||||||||||||||| |||||||||| |
|
|
| T |
30639477 |
tgcatatgcgggagctttagtgcactgggttgccctt |
30639513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 152
Target Start/End: Original strand, 40915830 - 40915965
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac |
115 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||| || |||||| ||||||||||||||| ||||||||||| || ||| | | || | | |
|
|
| T |
40915830 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-caaggtaaggctgcgtacaatacaccaaatggtgggagcccttcccggaccctgc |
40915928 |
T |
 |
| Q |
116 |
gtatgcgggagctttagtgcaccaggttgcccttatt |
152 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
40915929 |
gtatgcgggagcttcagtgcaccggattgcccttatt |
40915965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 41 - 149
Target Start/End: Original strand, 23501813 - 23501923
Alignment:
| Q |
41 |
acagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||| ||| | | || | | |||||||||||||||||||||| |
|
|
| T |
23501813 |
acagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
23501912 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
23501913 |
gggttgccctt |
23501923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 9832448 - 9832314
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
9832448 |
tgaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
9832351 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||| ||| || ||||||||| |||||||||| |
|
|
| T |
9832350 |
tgcatatgcaggaactctagtgcaccgggttgccctt |
9832314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 11054283 - 11054149
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||| ||||||||||||| ||||||||||||||||||||||||| |||||| || |||| ||| | | || |
|
|
| T |
11054283 |
tgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaaaa--cagggtaagactgcgtacaatacaccaaatggcggaaccccttcccggaccc |
11054186 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
11054185 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
11054149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 138
Target Start/End: Original strand, 19027846 - 19027971
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||||| | ||||||||||||||||||||||| ||||||||||||||| || ||||||||||| || ||| | |
|
|
| T |
19027846 |
tgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggacccctttccagactc |
19027945 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
| |||||| ||||||||||||||||| |
|
|
| T |
19027946 |
tgcgtatgtgggagctttagtgcacc |
19027971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 20224982 - 20225116
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||| |||||| || || ||||| |||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
20224982 |
tgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
20225079 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
20225080 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
20225116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 148
Target Start/End: Complemental strand, 29208033 - 29207900
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||| ||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
29208033 |
tgaaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
29207936 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccct |
148 |
Q |
| |
|
| | |||||||||||| ||||||||| ||||||||| |
|
|
| T |
29207935 |
tgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 35567168 - 35567304
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||| |||||| || || |||||||| |||||||||||||||||||||| ||| |||||| |||| |||||||||||||| ||| | || |
|
|
| T |
35567168 |
tgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaatggtgggaccccttcccgaaccc |
35567267 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| ||| |||||||||||||||||||| || ||||||| |
|
|
| T |
35567268 |
tgcgtctgcgggagctttagtgcaccgggctgccctt |
35567304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 54 - 149
Target Start/End: Complemental strand, 30690272 - 30690177
Alignment:
| Q |
54 |
taaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| || ||||||||||| ||| | | || | ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30690272 |
taaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgccctt |
30690177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 136
Target Start/End: Original strand, 37494849 - 37494972
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc-tttcgcagccc |
111 |
Q |
| |
|
|||||||||||| |||||| || || ||||| ||||||||||||||||||||||||| ||| ||||||| || |||||||||||||| ||||| ||| |
|
|
| T |
37494849 |
tgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatataccaaatggtgggacccctttcgggaccc |
37494948 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
| ||||||| |||||||||||||| |
|
|
| T |
37494949 |
tg-cgtatgcaggagctttagtgca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 5306800 - 5306661
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
5306800 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaat-cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccc |
5306702 |
T |
 |
| Q |
113 |
tacgtatg----cgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
5306701 |
tgcgtatgtggacgggagctttaatgcaccgggttgccctt |
5306661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 47 - 149
Target Start/End: Complemental strand, 12711553 - 12711450
Alignment:
| Q |
47 |
tcttgtgtaaaaaac-agggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgc |
145 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| ||||||| ||| ||| ||| ||||||||| | |||||||||||| ||||| |
|
|
| T |
12711553 |
tcttgtgtaaaaaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacccagttgc |
12711454 |
T |
 |
| Q |
146 |
cctt |
149 |
Q |
| |
|
|||| |
|
|
| T |
12711453 |
cctt |
12711450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 20405110 - 20405223
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgc |
135 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||| ||| | | || | ||||||||||||||||||| |
|
|
| T |
20405110 |
aaacagcctcttgtgtaaaaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgc |
20405209 |
T |
 |
| Q |
136 |
accaggttgccctt |
149 |
Q |
| |
|
| |||||||||| |
|
|
| T |
20405210 |
attgggttgccctt |
20405223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 16911586 - 16911698
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||||||||||||| | ||||||||||||| ||| | | || | |||| |||||||||||||| | |
|
|
| T |
16911586 |
aaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagttta |
16911685 |
T |
 |
| Q |
137 |
ccaggttgccctt |
149 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
16911686 |
ccgggttgccctt |
16911698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 150
Target Start/End: Complemental strand, 7909391 - 7909280
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgc-gggagctttagtgcac |
137 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| |||||||||||||| |||||||||||||| ||| | || | ||||||| ||||||||||||||| |
|
|
| T |
7909391 |
aaacagtctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcat |
7909293 |
T |
 |
| Q |
138 |
caggttgccctta |
150 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
7909292 |
cgggttgccctta |
7909280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 26 - 150
Target Start/End: Complemental strand, 8473744 - 8473620
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcag--cccttacgtatgcgg |
123 |
Q |
| |
|
|||||| || || |||||||||||||||| || ||||||||| |||| |||||||||| |||||||||||||| ||| | | ||| | | ||||||| |
|
|
| T |
8473744 |
gttcaagtcctggaaacagcctcttgtgtttaa--cagggtaaggctgcatacaatacaccaaatggtgggaccccttccccggacccctgcatatgcgg |
8473647 |
T |
 |
| Q |
124 |
gagctttagtgcaccaggttgccctta |
150 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
8473646 |
gagctttagtgcaccgggttgccctta |
8473620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 150
Target Start/End: Original strand, 21489111 - 21489223
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||| || | |||||||||||||| ||| | || | |||||||||||||||| |||||| |
|
|
| T |
21489111 |
aaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcac |
21489210 |
T |
 |
| Q |
138 |
caggttgccctta |
150 |
Q |
| |
|
|||||| |||| |
|
|
| T |
21489211 |
tgggttgctctta |
21489223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 13 - 141
Target Start/End: Original strand, 25463120 - 25463247
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||||| ||||||||||||||||| ||| ||| ||||||||| |||| |||||||||||||| ||| | | || |
|
|
| T |
25463120 |
tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccccttcccggaccc |
25463219 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccagg |
141 |
Q |
| |
|
| | |||||||||||||| |||||||||| |
|
|
| T |
25463220 |
tgcatatgcgggagcttt-gtgcaccagg |
25463247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 54175088 - 54175199
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtggga-ccctttcgcagcccttacgtatgcgggagctttagtgca |
136 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||| | ||||||||||| ||||| | | | || | | |||||||||||||||||||| |
|
|
| T |
54175088 |
aaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaaatggtgggaccccttccccggaccctgcatatgcgggagctttagtgca |
54175186 |
T |
 |
| Q |
137 |
ccaggttgccctt |
149 |
Q |
| |
|
|| || ||||||| |
|
|
| T |
54175187 |
ccgggctgccctt |
54175199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 138
Target Start/End: Complemental strand, 9987945 - 9987846
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||| ||||||||||||| || |||||||| |||| |||||||||| |||||||||||||| ||| | |||| | ||||||||||||||| |||||| |
|
|
| T |
9987945 |
aaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggagctttaatgcacc |
9987846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 58 - 149
Target Start/End: Complemental strand, 55766558 - 55766467
Alignment:
| Q |
58 |
aaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||| |||| || | | |||| |||||||| ||||||||||||||| || ||||||| |
|
|
| T |
55766558 |
aaacagggtaaggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgccctt |
55766467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 58 - 149
Target Start/End: Complemental strand, 55830813 - 55830722
Alignment:
| Q |
58 |
aaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |||| || | | |||| |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
55830813 |
aaacagggtaatgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgccctt |
55830722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 43 - 149
Target Start/End: Complemental strand, 13256508 - 13256400
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccag |
140 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| | ||| ||||||||| ||| | || | | |||||||||||||||||||| | |
|
|
| T |
13256508 |
agcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgg |
13256409 |
T |
 |
| Q |
141 |
gttgccctt |
149 |
Q |
| |
|
||||||||| |
|
|
| T |
13256408 |
gttgccctt |
13256400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 47 - 104
Target Start/End: Complemental strand, 17079754 - 17079697
Alignment:
| Q |
47 |
tcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttc |
104 |
Q |
| |
|
||||||||| ||||||||||||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
17079754 |
tcttgtgtataaaacagggtaaggctgcatacaatacgctaaatggtgggaccctttc |
17079697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 39 - 99
Target Start/End: Complemental strand, 39029172 - 39029111
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac-taaatggtgggacc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
39029172 |
aaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaatggtgggacc |
39029111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 7038051 - 7038122
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
|||||||||||| |||||| || || ||||||| |||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7038051 |
tgaaaggtcacaggttcaagtcctg-aaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacac |
7038122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 41018930 - 41018807
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||||||||||||| |||||||| || |||||||||||| |||| ||||||||| ||| ||| ||| |
|
|
| T |
41018930 |
tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatt-agggtaaggctacgtacaatacaccaaatagtgggaccccttcccagacct |
41018832 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
| |||||| || |||||||||||| |
|
|
| T |
41018831 |
tgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 13 - 104
Target Start/End: Complemental strand, 7385613 - 7385522
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttc |
104 |
Q |
| |
|
||||||||||| |||||| | || |||||||||| ||||||||||| |||||||| || || |||||||| |||||||||||||||||| |
|
|
| T |
7385613 |
tgaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtgggaccctttc |
7385522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 39 - 129
Target Start/End: Original strand, 49796822 - 49796911
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctt |
129 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||| |||||||||||||| ||| | || | ||||||||||||||| |
|
|
| T |
49796822 |
aaacagcctcttgtgttaaaa-catggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 13 - 147
Target Start/End: Original strand, 54967019 - 54967151
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||||| |||||| | || ||| | ||||||||||||||||||||||||| ||| ||||||| || |||||||||||||| ||| | || |
|
|
| T |
54967019 |
tgaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaaggttgc-tacaatataccaaatggtgggaccccttcccgtaccc |
54967117 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
||| |||||||||||||| ||||||| || ||||| |
|
|
| T |
54967118 |
tacatatgcgggagcttt-gtgcaccgggctgccc |
54967151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 487272 - 487187
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacact-aaatggtggga |
97 |
Q |
| |
|
||||||||||| |||||| || || ||||| ||||||||||| |||||| ||||| |||||||||||||||| ||||||||||| |
|
|
| T |
487272 |
tgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaaatggtggga |
487187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 60 - 149
Target Start/End: Original strand, 20225119 - 20225210
Alignment:
| Q |
60 |
acagggtaagactgcgtacaatacactaa--atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||||||||||| ||| | | || | |||||||||||||||||||||| |||||||||| |
|
|
| T |
20225119 |
acagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt |
20225210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 54 - 149
Target Start/End: Complemental strand, 20908733 - 20908637
Alignment:
| Q |
54 |
taaaaaacagggtaagactgcgtacaatacactaaa-tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||| | |||||| ||||||||||||||| ||| ||||||||||| ||| | || | ||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
20908733 |
taaaaaagaaggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccctt |
20908637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 85
Target Start/End: Original strand, 25343189 - 25343257
Alignment:
| Q |
17 |
aggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
|||||||| |||||| | || ||| || |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25343189 |
aggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacac |
25343257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 48327869 - 48327814
Alignment:
| Q |
46 |
ctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggacc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
48327869 |
ctcttgtgtaaaaaacagggtaagactgcatacaatacaccaataatggtgggacc |
48327814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 39077931 - 39077800
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggac-cctttcgcagccc |
111 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||| ||||||||||||| ||||||||||| || |||||||| ||| ||||| | | || |
|
|
| T |
39077931 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggttgcgtacaatataccaaatggtgagacatctttc-cggacc |
39077835 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttagtgcaccaggttgcc |
146 |
Q |
| |
|
| | |||||||||||| ||||||||| ||||||| |
|
|
| T |
39077834 |
ctgcatatgcgggagctctagtgcaccgggttgcc |
39077800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 47441667 - 47441580
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc |
100 |
Q |
| |
|
|||||||||||| |||||| || |||||| ||||| |||||||| ||||||||| ||| ||||||||||| ||||||| |||||| |
|
|
| T |
47441667 |
tgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaatggttggaccc |
47441580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 132
Target Start/End: Complemental strand, 49938727 - 49938611
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc |
111 |
Q |
| |
|
|||||||||||| |||||| || || ||||||||||||||||| ||||| ||||||| | |||||||||| | |||||||||||||| ||| || || |
|
|
| T |
49938727 |
tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgta-aaaacggggtaag---gtgtacaatacaccaaaatggtgggaccccttcccatacc |
49938632 |
T |
 |
| Q |
112 |
ttacgtatgcgggagctttag |
132 |
Q |
| |
|
| | |||||||||||||||| |
|
|
| T |
49938631 |
ctgcatatgcgggagctttag |
49938611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 39 - 99
Target Start/End: Original strand, 14590861 - 14590922
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacactaaatggtgggacc |
99 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
14590861 |
aaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacc |
14590922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 71 - 149
Target Start/End: Complemental strand, 30352661 - 30352581
Alignment:
| Q |
71 |
ctgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||| |
|
|
| T |
30352661 |
ctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctt |
30352581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 88 - 149
Target Start/End: Complemental strand, 38755970 - 38755909
Alignment:
| Q |
88 |
aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||| ||| | | || | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
38755970 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
38755909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 100
Target Start/End: Complemental strand, 30581591 - 30581515
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaa-aaaacagggtaagactgcgtacaataca-ctaaatggtgggaccc |
100 |
Q |
| |
|
|||||| ||||| ||||| |||||||||||| ||||||||||||| || |||||||||| | |||||||||||||| |
|
|
| T |
30581591 |
gttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaatggtgggaccc |
30581515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 115 - 158
Target Start/End: Original strand, 35532092 - 35532135
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgcccttattgttttt |
158 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
35532092 |
cgtatgcgggagctttagtgcaccgggttgcccttttttttttt |
35532135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 149
Target Start/End: Original strand, 2813169 - 2813262
Alignment:
| Q |
59 |
aacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagcttt-agtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||| | | | |||||||||||||||| |||||||| | |||||||| |
|
|
| T |
2813169 |
aacagggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgccctt |
2813262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Original strand, 11394952 - 11394986
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
11394952 |
cgtatgcgggagctttagtgcaccgggttgccctt |
11394986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Original strand, 11404679 - 11404713
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
11404679 |
cgtatgcgggagctttagtgcaccgggttgccctt |
11404713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 77
Target Start/End: Complemental strand, 23580315 - 23580281
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgta |
77 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23580315 |
agcctcttgtgtaaaaaacaggggaagactgcgta |
23580281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 98
Target Start/End: Complemental strand, 30496457 - 30496374
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggac |
98 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||||||| | ||||||| |||| |||||||||| |||||| ||||| |
|
|
| T |
30496457 |
tgaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaaca--cgggtaaggctgcatacaatacaccaaatggggggac |
30496374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 149
Target Start/End: Original strand, 38786673 - 38786743
Alignment:
| Q |
79 |
aatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
38786673 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
38786743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Complemental strand, 40553972 - 40553938
Alignment:
| Q |
115 |
cgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
40553972 |
cgtatgcgggagctttagtgcaccgggttgccctt |
40553938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 85
Target Start/End: Original strand, 51420598 - 51420644
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
51420598 |
aaacaacctcttgtgtagaaaacagggtaaggctgggtacaatacac |
51420644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 88 - 149
Target Start/End: Complemental strand, 33836549 - 33836488
Alignment:
| Q |
88 |
aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||||||||| ||| | | || | |||||||||||||||||||||| | |||||||||| |
|
|
| T |
33836549 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctt |
33836488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 149
Target Start/End: Complemental strand, 10277879 - 10277758
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
||||||||| | |||||||||||||| ||||| | || |||| ||||||||||||||| |||||||| |||| ||| ||| || | | ||||||||| |
|
|
| T |
10277879 |
gttcaaatccttgaaacagcctcttgtataaaata--ggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatgcggga |
10277782 |
T |
 |
| Q |
126 |
gctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | ||||| ||| | |||||||| |
|
|
| T |
10277781 |
gttctagtgaaccggattgccctt |
10277758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 134
Target Start/End: Original strand, 16494259 - 16494338
Alignment:
| Q |
57 |
aaaacagggtaagactgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtg |
134 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||| ||||||||||||||| ||| || | |||||||| |||||||||| |
|
|
| T |
16494259 |
aaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtg |
16494338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 149
Target Start/End: Complemental strand, 32478918 - 32478793
Alignment:
| Q |
17 |
aggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacg |
116 |
Q |
| |
|
|||||||| |||||| || || ||||| ||||| ||||||||| ||||||||| ||| ||||||| |||||||||||||| ||| | | || || |
|
|
| T |
32478918 |
aggtcacaggttcaagtcctggaaacaacctctagtgtaaaaa-cagggtaaggctg-----aatacaccaaatggtgggaccccttcccggacccagcg |
32478825 |
T |
 |
| Q |
117 |
tatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||| |
|
|
| T |
32478824 |
tatgcgggagcttt-gtgcaccgggtggccctt |
32478793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 149
Target Start/End: Original strand, 32484335 - 32484367
Alignment:
| Q |
117 |
tatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
32484335 |
tatgcgggagctttagtgcaccgggttgccctt |
32484367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 100
Target Start/End: Complemental strand, 35894563 - 35894511
Alignment:
| Q |
49 |
ttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccc |
100 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
35894563 |
ttgtgtaaaaaacacggtaagtgtgcgtacaatacaccaaaatggtgggaccc |
35894511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 149
Target Start/End: Original strand, 44718641 - 44718701
Alignment:
| Q |
89 |
atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||| ||| ||| || | |||||||||||||||||| |||| |||||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgccctt |
44718701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 149
Target Start/End: Original strand, 56323002 - 56323034
Alignment:
| Q |
117 |
tatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
56323002 |
tatgcgggagctttagtgcaccgggttgccctt |
56323034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 63; Significance: 2e-27; HSPs: 4)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 40 - 158
Target Start/End: Complemental strand, 24882 - 24764
Alignment:
| Q |
40 |
aacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacca |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||| ||| | || | |||||||||||||||||||||| | |
|
|
| T |
24882 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagcc |
24783 |
T |
 |
| Q |
140 |
ggttgcccttattgttttt |
158 |
Q |
| |
|
|||||||||| || ||||| |
|
|
| T |
24782 |
ggttgcccttttttttttt |
24764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 39 - 149
Target Start/End: Original strand, 46855 - 46965
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
||||| |||||||||||||||| |||||||| |||||||||||||| |||||||||||||| ||| | | || | |||||||||||||||||||||||| |
|
|
| T |
46855 |
aaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
46954 |
T |
 |
| Q |
139 |
aggttgccctt |
149 |
Q |
| |
|
|||||||||| |
|
|
| T |
46955 |
gggttgccctt |
46965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 39 - 137
Target Start/End: Original strand, 43683 - 43780
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggga-ccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||||| |||||||||||| || |||||| ||||||||||||||| ||||||||||| ||||||| | | || | | |||||||||||| |||||||| |
|
|
| T |
43683 |
aaacagcgtcttgtgtaaaa--caaggtaaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagctctagtgcac |
43780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 147
Target Start/End: Complemental strand, 46770 - 46710
Alignment:
| Q |
87 |
aaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc |
147 |
Q |
| |
|
|||||||||||||| ||| ||| || | ||||||||||||||||| |||| |||| ||||| |
|
|
| T |
46770 |
aaatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgcatcaggctgccc |
46710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 13160 - 13025
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||| ||||||| || |||||| ||||||||||||||| ||||||||||||| ||| ||| || |
|
|
| T |
13160 |
tgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaa-caaggtaaggctgcgtacaatacaccgaatggtgggaccccttcccagaccc |
13062 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
13061 |
tgcgtatgcgggggctttagtgcaccgggttgccctt |
13025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 30577 - 30711
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||||||| | ||||||||||||||| |||||||||||||| ||| | | || |
|
|
| T |
30577 |
tgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtagggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
30674 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
30675 |
tgcatatgcgggagctctagtgcaccgggttgccctt |
30711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 26 - 149
Target Start/End: Complemental strand, 48756 - 48635
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| | ||| |||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | ||||||||| |
|
|
| T |
48756 |
gttcaagtggtggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga |
48659 |
T |
 |
| Q |
126 |
gctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||| ||||||||| |||||||||| |
|
|
| T |
48658 |
gctctagtgcaccgggttgccctt |
48635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 39 - 137
Target Start/End: Original strand, 10834 - 10932
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac |
137 |
Q |
| |
|
||||| ||||||||||||||||||||||| | |||||| |||||||| |||||||||||||| ||| | | || | ||||||||||||||||||||||| |
|
|
| T |
10834 |
aaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
10932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 46 - 149
Target Start/End: Complemental strand, 72971 - 72868
Alignment:
| Q |
46 |
ctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgc |
145 |
Q |
| |
|
||||||||||||||||| |||||| |||| |||||||||| ||||||| | |||| ||| | | | | ||||||||||||||||||||||||||||||| |
|
|
| T |
72971 |
ctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgc |
72872 |
T |
 |
| Q |
146 |
cctt |
149 |
Q |
| |
|
|||| |
|
|
| T |
72871 |
cctt |
72868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 149
Target Start/End: Original strand, 11129 - 11263
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| | || |||| |||| |||||||||| |||||||||||| | ||| | | || |
|
|
| T |
11129 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaag--taaggctgcttacaatacaccaaatggtgggacaccttcccggaccc |
11226 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
| | |||||||||||| |||||||||||||||||||| |
|
|
| T |
11227 |
tgcatatgcgggagctctagtgcaccaggttgccctt |
11263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 148
Target Start/End: Complemental strand, 10185 - 10052
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||| ||||||||||||||||||||| |||| ||||||||| ||| | | || |
|
|
| T |
10185 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccc |
10088 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccct |
148 |
Q |
| |
|
| | ||||| |||||| |||||||| ||||||||| |
|
|
| T |
10087 |
tgcatatgcaggagctccagtgcaccgggttgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 148
Target Start/End: Complemental strand, 20513 - 20380
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
||||||||||| |||||| || || |||||||||||||||||||| ||| ||||||||||||||||||||| |||| ||||||||| ||| | | || |
|
|
| T |
20513 |
tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccc |
20416 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgccct |
148 |
Q |
| |
|
| | ||||| |||||| |||||||| ||||||||| |
|
|
| T |
20415 |
tgcatatgcaggagctccagtgcaccgggttgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 1722 - 1591
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct |
112 |
Q |
| |
|
|||||||||| |||||| || || ||||| |||||||||||||| |||| |||| |||| |||||||||| ||||| |||||||| ||| | | || |
|
|
| T |
1722 |
tgaaaggtcatgggttcaagtcctgaaaacaacctcttgtgtaaaa--caggataaggctgcatacaatacaccaaatgatgggaccccttcccggaccc |
1625 |
T |
 |
| Q |
113 |
tacgtatgcgggagctttagtgcaccaggttgcc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1624 |
ggcgtatgcgggagctttagtgcaccaggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 16 - 104
Target Start/End: Complemental strand, 35152 - 35063
Alignment:
| Q |
16 |
aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaa-aaaacagggtaagactgcgtacaatacactaaatggtgggaccctttc |
104 |
Q |
| |
|
|||||||| |||||| || || |||||| ||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
35152 |
aaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccctttc |
35063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 130
Target Start/End: Original strand, 23610 - 23714
Alignment:
| Q |
26 |
gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga |
125 |
Q |
| |
|
|||||| || || ||||| |||||||||||||||||||||| || ||||||||||| | |||||||||||||| ||| ||| |||| ||||| |||| |
|
|
| T |
23610 |
gttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagcaaatggtgggaccccttcccagaccttgagtatgtggga |
23709 |
T |
 |
| Q |
126 |
gcttt |
130 |
Q |
| |
|
||||| |
|
|
| T |
23710 |
gcttt |
23714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 63 - 149
Target Start/End: Complemental strand, 24220 - 24134
Alignment:
| Q |
63 |
gggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt |
149 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| | |||||||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctt |
24134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 105
Target Start/End: Original strand, 32960 - 33021
Alignment:
| Q |
45 |
cctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa-tggtgggaccctttcg |
105 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
32960 |
cctcttctgtaaaaaacagagtaagactgtatacaatacaccaaattggtgggaccctttcg |
33021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 39 - 99
Target Start/End: Complemental strand, 226517 - 226456
Alignment:
| Q |
39 |
aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggacc |
99 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
226517 |
aaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacc |
226456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 4155 - 4227
Alignment:
| Q |
13 |
tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac |
85 |
Q |
| |
|
||||||||||| |||||| || || ||||| |||||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
4155 |
tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacac |
4227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 138
Target Start/End: Original strand, 3572 - 3667
Alignment:
| Q |
43 |
agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc |
138 |
Q |
| |
|
|||||||||||||||| | | |||||| ||||||| ||||||| |||| |||||||| ||| | || | ||||||||| |||||||||||||| |
|
|
| T |
3572 |
agcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcacc |
3667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 159
Target Start/End: Original strand, 24696 - 24792
Alignment:
| Q |
63 |
gggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgttttta |
159 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||| ||| || ||| || | ||||| ||||||||| |||||||| | |||||||| || |||||| |
|
|
| T |
24696 |
gggtaagactgcgtataatacaccaaatagtggaccccctttccagaccctgcgtatacgggagcttcagtgcacctgattgcccttttttttttta |
24792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University