View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_50 (Length: 238)
Name: NF0834_low_50
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0834_low_50 |
 |  |
|
[»] scaffold1113 (2 HSPs) |
 |  |  |
|
[»] scaffold0961 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 42 - 223
Target Start/End: Complemental strand, 32684230 - 32684049
Alignment:
Q |
42 |
aacttagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctacaatttatcttcgaccaaatttg |
141 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32684230 |
aacttagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctacaatttatcttcgaccaaatttg |
32684131 |
T |
 |
Q |
142 |
agattcttacaatgatatccacacaccttcatgtcaaattcccctatctctgattcattcatgttatcacaggttcctaact |
223 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32684130 |
agattcttacaatgatatccacacaccttcatgtcaaatttccctatctctgattcattcatgttatcacaggttcctaact |
32684049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 42 - 80
Target Start/End: Complemental strand, 32692128 - 32692090
Alignment:
Q |
42 |
aacttagaatcaaaattattgttagagaaaaacttgcct |
80 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32692128 |
aacttagaatcaaaattattgttagagaaaaacttgcct |
32692090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 42 - 119
Target Start/End: Original strand, 57 - 134
Alignment:
Q |
42 |
aacttagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctac |
119 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
T |
57 |
aacttagaatcaaaattattgttagagaaaaacttgcctcgaatgctaaatcagcatccggctcattcacgcgtctac |
134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 80
Target Start/End: Original strand, 1872 - 1904
Alignment:
Q |
48 |
gaatcaaaattattgttagagaaaaacttgcct |
80 |
Q |
|
|
|||||||||| |||||||||||||||||||||| |
|
|
T |
1872 |
gaatcaaaatcattgttagagaaaaacttgcct |
1904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0961 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0961
Description:
Target: scaffold0961; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 80
Target Start/End: Complemental strand, 1745 - 1713
Alignment:
Q |
48 |
gaatcaaaattattgttagagaaaaacttgcct |
80 |
Q |
|
|
|||||||||| |||||||||||||||||||||| |
|
|
T |
1745 |
gaatcaaaatcattgttagagaaaaacttgcct |
1713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University