View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0834_low_51 (Length: 237)

Name: NF0834_low_51
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0834_low_51
NF0834_low_51
[»] chr1 (1 HSPs)
chr1 (15-110)||(42059306-42059401)


Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 15 - 110
Target Start/End: Complemental strand, 42059401 - 42059306
Alignment:
15 ttagattgatcattaagttcattggttaaaggaataaatttccacgacatcaaaattcattttgaactttatatctctgcaatgtggaacttgata 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42059401 ttagattgatcattaagttcattggttaaaggaataaatttccacgacatcaaaattcattttgaactttatatctctgcaatgtggaacttgata 42059306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University