View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_65 (Length: 217)
Name: NF0834_low_65
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_low_65 |
 | |
|
| [»] scaffold1113 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 37 - 212
Target Start/End: Original strand, 32684055 - 32684230
Alignment:
| Q |
37 |
gaacctgtgataacatgaatgaatcagagataggggaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684055 |
gaacctgtgataacatgaatgaatcagagatagggaaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgt |
32684154 |
T |
|
| Q |
137 |
agacgcatgaatgagccggatgctgatttagcattcaaggcaagtctttctctaacaataattttgattctaagtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32684155 |
agacgcatgaatgagccggatgctgatttagcattcaaggcaagtttttctctaacaataattttgattctaagtt |
32684230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 32692090 - 32692128
Alignment:
| Q |
174 |
aggcaagtctttctctaacaataattttgattctaagtt |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32692090 |
aggcaagtttttctctaacaataattttgattctaagtt |
32692128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 135 - 212
Target Start/End: Complemental strand, 134 - 57
Alignment:
| Q |
135 |
gtagacgcatgaatgagccggatgctgatttagcattcaaggcaagtctttctctaacaataattttgattctaagtt |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
134 |
gtagacgcgtgaatgagccggatgctgatttagcattcgaggcaagtttttctctaacaataattttgattctaagtt |
57 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3019 times since January 2019
Visitors: 6168