View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_82 (Length: 202)
Name: NF0834_low_82
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0834_low_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 9 - 185
Target Start/End: Complemental strand, 40325469 - 40325293
Alignment:
Q |
9 |
acatcatcattcaccctttcggttaaacgatcagttgcttcaannnnnnncttaacatgatctcggtttgaaatcaccttcatcttttcgctttccacat |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40325469 |
acatcatcattcaccctttcggttaaacgatcagttgcttcaatttttttcttaacatgatctcggtttgaaatcaccttcatcttttcgctttccacat |
40325370 |
T |
 |
Q |
109 |
tttttattgttttgcgagcccgattgtcacgtcgttcgtcgatttggcttaccagaatacaagttccgactaagcaa |
185 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40325369 |
tttttattgttttgcgagcccgattgtcacgtcgttcgtcgatttggcttaccagaatacaagttccgactaagcaa |
40325293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3315 times since January 2019
Visitors: 6172