View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0834_low_85 (Length: 201)
Name: NF0834_low_85
Description: NF0834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0834_low_85 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 39519708 - 39519853
Alignment:
| Q |
1 |
aaaatgttgaaagaaattgaaacagtaacaaatattagatgaaaatggatagaaagagaacctgaacttggctaagaactggaaaattttcaatggtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39519708 |
aaaatgttgaaagaaattgaaacaataacaaatattagatgaaaatggatagaaagagaacctgaacttggctaagaactggaaaattttcaatggtttt |
39519807 |
T |
 |
| Q |
101 |
gtagtaatcagcaatgaaatcaaccatcttatgaccttgctctctc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
39519808 |
gtagtaatcagcaatgaaatcaaccatcatatgaccttgttctctc |
39519853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 39532166 - 39532311
Alignment:
| Q |
1 |
aaaatgttgaaagaaattgaaacagtaacaaatattagatgaaaatggatagaaagagaacctgaacttggctaagaactggaaaattttcaatggtttt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
39532166 |
aaaatattgaaagaaattgaaacagtaacaaatattagatgaaaatggatagaaagagaacctgaacttggctaagaacagggaaattttcaattgtttt |
39532265 |
T |
 |
| Q |
101 |
gtagtaatcagcaatgaaatcaaccatcttatgaccttgctctctc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
39532266 |
gtagtaatcagcaatgaaatcaaccatcatatgaccttgttctctc |
39532311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University