View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0835_high_10 (Length: 251)
Name: NF0835_high_10
Description: NF0835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0835_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 12813418 - 12813658
Alignment:
| Q |
1 |
ctttagctatgtcattcaaatgggctactcatgtctcgtacacgatggccctaatgggtagcgggttctaatttagtgcttcatagatgttactaattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12813418 |
ctttagctatgtcattcaaatgggctactcatgtctcgtacacgttggccctaatgggtagcgggttctaatttagtgcttcatatatgttactaattta |
12813517 |
T |
|
| Q |
101 |
gtttagtattttcagctatgtcatccaaacagattactcatgtttcgtacatgttagccctaacggatagcgagtttatttttggtcgggctaaaatgcc |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12813518 |
gtttagtatttttagctatgtcatccaaacaggttactcatgtttcgtacatgttagccctaacggatagcgagtttatttttggtggggctaaaatgcc |
12813617 |
T |
|
| Q |
201 |
ctgaaaaatccgatatgaaattttaaagcacataccctatg |
241 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
12813618 |
ctgaaaaatccgagatgaaattttaaagcatataccctatg |
12813658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 68 - 172
Target Start/End: Original strand, 12813377 - 12813480
Alignment:
| Q |
68 |
ctaatttagtgcttcatagatgttactaatttagtttagtattttcagctatgtcatccaaacagattactcatgtttcgtacatgttagccctaacgga |
167 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||| ||| ||||||||||| |||| | ||||||||| ||||||| ||| ||||||| || |
|
|
| T |
12813377 |
ctaatttagtgtttcatgaatgttactaatttagtttagtacttt-agctatgtcattcaaatgggctactcatgtctcgtacacgttggccctaatggg |
12813475 |
T |
|
| Q |
168 |
tagcg |
172 |
Q |
| |
|
||||| |
|
|
| T |
12813476 |
tagcg |
12813480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2191 times since January 2019
Visitors: 6159