View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0835_high_8 (Length: 252)
Name: NF0835_high_8
Description: NF0835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0835_high_8 |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 152 - 252
Target Start/End: Original strand, 9659214 - 9659314
Alignment:
Q |
152 |
aagggagaagaggactcacatatcttcaacatactttgaagcaaccataatagttgttatgagaagtctatgaacatttcttgaattaattctaaaccca |
251 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9659214 |
aagggagaagaggacttacatatcttcaacatactttgaagcaaccataatagttgttatgagaagtctatgaacatttcttgaattaattctaaaccca |
9659313 |
T |
 |
Q |
252 |
a |
252 |
Q |
|
|
| |
|
|
T |
9659314 |
a |
9659314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 53
Target Start/End: Original strand, 9659026 - 9659066
Alignment:
Q |
13 |
aatattggggatccaacatgcatgaccattggccatgcttt |
53 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9659026 |
aatattggggatccaacatgcatgaccattggccatgcttt |
9659066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University