View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0835_high_8 (Length: 252)

Name: NF0835_high_8
Description: NF0835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0835_high_8
NF0835_high_8
[»] chr4 (2 HSPs)
chr4 (152-252)||(9659214-9659314)
chr4 (13-53)||(9659026-9659066)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 152 - 252
Target Start/End: Original strand, 9659214 - 9659314
Alignment:
152 aagggagaagaggactcacatatcttcaacatactttgaagcaaccataatagttgttatgagaagtctatgaacatttcttgaattaattctaaaccca 251  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9659214 aagggagaagaggacttacatatcttcaacatactttgaagcaaccataatagttgttatgagaagtctatgaacatttcttgaattaattctaaaccca 9659313  T
252 a 252  Q
    |    
9659314 a 9659314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 53
Target Start/End: Original strand, 9659026 - 9659066
Alignment:
13 aatattggggatccaacatgcatgaccattggccatgcttt 53  Q
    |||||||||||||||||||||||||||||||||||||||||    
9659026 aatattggggatccaacatgcatgaccattggccatgcttt 9659066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 97 times since January 2019
Visitors: 6125