View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0835_low_15 (Length: 244)
Name: NF0835_low_15
Description: NF0835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0835_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 97 - 210
Target Start/End: Complemental strand, 27425093 - 27424980
Alignment:
| Q |
97 |
atcaccgagatataaaatgtttacctgagggtacactgatgctagatatgatgcttcctttgagaatggataggatgcatgtaaaagaacaatccgagat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27425093 |
atcaccgagatataaaatgtttacctgagggtacactgatgctagatatgatgcttcctttgagaatggataggatgcatgtaaaagaacaatccgagat |
27424994 |
T |
|
| Q |
197 |
tttgaatatttctt |
210 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27424993 |
tttgaatatttctt |
27424980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 98 - 210
Target Start/End: Complemental strand, 27404064 - 27403952
Alignment:
| Q |
98 |
tcaccgagatataaaatgtttacctgagggtacactgatgctagatatgatgcttcctttgagaatggataggatgcatgtaaaagaacaatccgagatt |
197 |
Q |
| |
|
|||| ||| ||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27404064 |
tcactgagttatgaaatgtttacctgagggtacacagatgctagatatgatgcttcccttgagaatggataggatgcatgtaaaagaacgatccgagatt |
27403965 |
T |
|
| Q |
198 |
ttgaatatttctt |
210 |
Q |
| |
|
|||| ||| |||| |
|
|
| T |
27403964 |
ttgagtatctctt |
27403952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 189
Target Start/End: Complemental strand, 27449950 - 27449901
Alignment:
| Q |
140 |
agatatgatgcttcctttgagaatggataggatgcatgtaaaagaacaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
27449950 |
agatatgatgcttcctttgagaatggatatgatgtatgtaaaagaacaat |
27449901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1314 times since January 2019
Visitors: 6140