View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0835_low_3 (Length: 449)
Name: NF0835_low_3
Description: NF0835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0835_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 136 - 421
Target Start/End: Original strand, 39380051 - 39380331
Alignment:
Q |
136 |
atatgcttgtagtatttcatttaagcatagtattttatttagactcgcacatact-atacacgcacaccctactcacggtagaaaagaaaatgaaaatac |
234 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
T |
39380051 |
atatgcttgtagtatttcatttaagcatagtatttcatttagactcgcacacacttatacacgcacaccctacttacagtagaaaagaaaatgaaaatac |
39380150 |
T |
 |
Q |
235 |
aacatacctctaaatagagatgttagaaaaattggtttacaaagggggagaacaagcaacggttaagcaatcacttacacacatatttttctccaaattt |
334 |
Q |
|
|
|||||||||||||| |||||||| ||||||| | |||||| | | |||||||||||| ||||||||||||||||| |||||||||||| ||||||| |
|
|
T |
39380151 |
aacatacctctaaacagagatgtcagaaaaactagtttacgacgagggagaacaagcgacggttaagcaatcact----cacatatttttc--caaattt |
39380244 |
T |
 |
Q |
335 |
gatattctatcttaaagcttatacatatgcttaagattagcttatgattattgtatcataaatatttttaatggaatgaacaacgtc |
421 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39380245 |
gatattctatcttagagcttatacatatgcttaagattagcttatgattattgtatcataaatatttttaatggaatgaacaacgtc |
39380331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University