View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_100 (Length: 266)
Name: NF0836_high_100
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_high_100 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 186 - 266
Target Start/End: Complemental strand, 35934252 - 35934173
Alignment:
| Q |
186 |
atcaatcaataattttgtaaatttgaagaatgaaactttaggatattttcccacaaaatttctaaaatggttcggaacaca |
266 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
35934252 |
atcaatcaata-ttttgtaaatttgaagaatgaaactttaggatattttcccacaaaatttctagaacggttcggaacaca |
35934173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 56 - 110
Target Start/End: Complemental strand, 35934343 - 35934289
Alignment:
| Q |
56 |
taaaaacaataaatttagactgcaaaatattagatatacgcaaaatccctgaaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35934343 |
taaaaacaataaatttagactgcaaaatattagatatacgcaaaatccccgaaca |
35934289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18 times since January 2019
Visitors: 6041