View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0836_high_101 (Length: 266)

Name: NF0836_high_101
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0836_high_101
NF0836_high_101
[»] chr1 (1 HSPs)
chr1 (21-237)||(8062785-8063001)


Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 21 - 237
Target Start/End: Complemental strand, 8063001 - 8062785
Alignment:
21 atgaaagaggggtagcaggacttgaagcttgagcttttccggcatcagcagaaggaggaagaacggcggcgccgccataagaagaagggttgttttgaat 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
8063001 atgaaagaggggtagcaggacttgaagcttgagcttttccggcatcagaagaaggaggaagaacggcggcgccgccataagaagaagggttgttttgaat 8062902  T
121 tgcagatctctgctttttacacccccatgagtatgttacactactcaacaaagagaaacgatgatataataaagcaagaatttcagcagtttcaacttcc 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8062901 tgcagatctctgctttttacacccccatgagtatgttacactactcaacaaagagaaacgatgatataataaagcaagaatttcagcagtttcaacttcc 8062802  T
221 ctttctgaccaatccaa 237  Q
    |||||||||||||||||    
8062801 ctttctgaccaatccaa 8062785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 99 times since January 2019
Visitors: 6050