View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_115 (Length: 257)
Name: NF0836_high_115
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_high_115 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 54 - 129
Target Start/End: Original strand, 37559103 - 37559178
Alignment:
Q |
54 |
gtatataatacaaacttgaaattccacacgccatggacaaactatgcattgatgtttttgatttatatgttgaata |
129 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
T |
37559103 |
gtatataatacaaacttgagattccacacgccatggacaaactatgcatgcatgtttctgatttatatgttgaata |
37559178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 197 - 257
Target Start/End: Complemental strand, 22996565 - 22996505
Alignment:
Q |
197 |
acatattatgtaatgcagctggtctaagattcaaaccgtctcgttaaaatgaaatagagct |
257 |
Q |
|
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22996565 |
acatatcatgtaatgcagctgatctaagattcaaaccgtctcgttaaaatgaaatagagct |
22996505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 110
Target Start/End: Complemental strand, 21359600 - 21359502
Alignment:
Q |
13 |
gctgttgcaatcttgtcttcactacctgca-aaaagcatcaggtatataatacaaacttgaaattccacacgccatggacaaactatgcattgatgttt |
110 |
Q |
|
|
|||| ||||||||| ||||||| ||||||| |||| || ||||||||||||||| |||| |||||||| |||| ||||||||||||||| ||||||| |
|
|
T |
21359600 |
gctgctgcaatcttatcttcaccacctgcagaaaaacacaaggtatataatacaagcttgggattccacatgccaaggacaaactatgcatggatgttt |
21359502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University