View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_130 (Length: 233)
Name: NF0836_high_130
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_high_130 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 9490406 - 9490621
Alignment:
| Q |
18 |
tatcagtggtgaagttttcatttgttaaagtgtatagaggaattgaagaacaaatttctttgttcagacctgaatctatgatccttattgtggaattttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9490406 |
tatcagtggtgaagttttcatttgttaaagtgtatagaggaattgaagagcaattttctttgttcagacctgaatctatgatccttattgtggaattttt |
9490505 |
T |
|
| Q |
118 |
gtagttgatggattctacaaagtactttccattgtatagatttagtattgtttgattcttctcacaggaaagttcataatttggatcaccgcagttttcg |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9490506 |
gtagttgatggattctacaaagtattttccattgtatagatttagtattgtttgattgttctcacaggaaagttcataatttggatcaccacagttttcg |
9490605 |
T |
|
| Q |
218 |
gggtcggtttgtagac |
233 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
9490606 |
ggatcggtttgtagac |
9490621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 100 times since January 2019
Visitors: 6050