View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_135 (Length: 221)
Name: NF0836_high_135
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_high_135 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 53123502 - 53123398
Alignment:
Q |
1 |
caattcaccagcgtataagagaaaaccaaaaccagtgaagaggcaaatacagatggaactaaacttcttggtattatgaaaggtcttcaatattttcatc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
53123502 |
caattcaccagcgtataagagaaaaccaaaaccagtgaagaggcaaatacagatggaactgaacttcttggtattatgaaaggtcttcaatattttcatt |
53123403 |
T |
 |
Q |
101 |
tcact |
105 |
Q |
|
|
||||| |
|
|
T |
53123402 |
tcact |
53123398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University