View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_141 (Length: 209)
Name: NF0836_high_141
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_high_141 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 26879240 - 26879152
Alignment:
Q |
1 |
gcagaactattgtattatggatctttgcccctttgaaatactgtctctaaactagagagcaactttactcggctccacatttcttaaaa |
89 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26879240 |
gcagaactattgtattatggatctttgcccctttgaaatactgtctctaaactagagagcaactttactcggctccacatttcttaaaa |
26879152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 40247225 - 40247185
Alignment:
Q |
1 |
gcagaactattgtattatggatctttgcccctttgaaatac |
41 |
Q |
|
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
T |
40247225 |
gcagaactagtgtattatggctctttgcccctttgaaatac |
40247185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University