View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_24 (Length: 517)
Name: NF0836_high_24
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 289 - 505
Target Start/End: Complemental strand, 34223353 - 34223137
Alignment:
Q |
289 |
aagagaacattgcattgcatatggtgtatgcatgagacaggctgtgggaaattcgctttgagagcactatcacaatgccttgctagagaatttcagcctc |
388 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34223353 |
aagagaacatgccattgcatatggtgtatgcatgagacaggctgtgggaaattcgctttgagagcactatcacaatgccttgctagagaatttcagcctc |
34223254 |
T |
 |
Q |
389 |
aaggagtgcatgtagctcatattattatcgatggttttattggcccaccaaggtgcgtttcgtttgtttatttgttcctagatcttctttcccttctctt |
488 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
34223253 |
aaggagtgcatgtagctcatattattatcgatggttttattggcccaccaaggtgcgtttcgtttgtttatttgttcctagatcttctttcccttttctt |
34223154 |
T |
 |
Q |
489 |
ttcctttcattcatatt |
505 |
Q |
|
|
||||||||||||||||| |
|
|
T |
34223153 |
ttcctttcattcatatt |
34223137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 28 - 207
Target Start/End: Complemental strand, 34223613 - 34223435
Alignment:
Q |
28 |
agttcgtctgctctgcgatccaacatatcaaatgtttctatgaagctaaataataatttatgaattaggtgctgccgggaatggttgaaagaggaaaggg |
127 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34223613 |
agttcgtctactctgcgatccaacatatcaaatgtttctatgaagctaaataatgatt-atgaattaggtgctgccgggaatggttgaaagaggaaaggg |
34223515 |
T |
 |
Q |
128 |
aacaattctattcactggttgctctgcttctttaaatggcattgctggatactctgaactatgtatgtaaatactataca |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34223514 |
aacaattctattcactggttgctctgcttctttaaatggcattgctggatactctgaactatgtatgtaaatactataca |
34223435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University