View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_53 (Length: 374)
Name: NF0836_high_53
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_high_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 149 - 287
Target Start/End: Complemental strand, 35162226 - 35162088
Alignment:
Q |
149 |
cggtaccattcataatagctttaaaaagttccgaatcagccctctttctactcgacctcttccccgttgaaacctcatccacatcatgcgataacggtaa |
248 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35162226 |
cggtaccattcataatagctttaaaaagttccgaatcagccctctttctactcgacctcttccccgttgaaacctcatccacatcatgcgataacggtaa |
35162127 |
T |
 |
Q |
249 |
ctccagctcattatgtggccccgcaatttccgattcatc |
287 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
35162126 |
ctccagctcattatgtggccccgtaatttccgattcatc |
35162088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University