View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0836_high_54 (Length: 370)

Name: NF0836_high_54
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0836_high_54
NF0836_high_54
[»] chr6 (1 HSPs)
chr6 (52-224)||(32315028-32315197)


Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 52 - 224
Target Start/End: Complemental strand, 32315197 - 32315028
Alignment:
52 tgatttgacacccttggttggaaattttgctcaactaatgcgatagagttaaatttgtttggacacttgacgtgggtttaacaaactcactcacatgttc 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32315197 tgatttgacacccttggttggaaattttgctcaactaatgcgatagagttaaatttgtttggacacttgacgtgggtttaacaaactcactcacatgttc 32315098  T
152 aattcagagtttgtagtagttcgtgatgaaaaaggaatctaacgtactgattttgtggattttgttggccttc 224  Q
    |||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32315097 aattcagagtttg---tagttcgtgatgaaaaaggaatctaacgtactgattttgtggattttgttggccttc 32315028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 146 times since January 2019
Visitors: 6045