View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0836_high_65 (Length: 348)

Name: NF0836_high_65
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0836_high_65
NF0836_high_65
[»] chr4 (1 HSPs)
chr4 (12-320)||(52170919-52171227)


Alignment Details
Target: chr4 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 12 - 320
Target Start/End: Complemental strand, 52171227 - 52170919
Alignment:
12 agagagcaaaagagcaaagaatttacaacagttgcaatgaaactcgccggaatcaaatcgatagacaacgctcacgacgactccgtttgggcagtcacat 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52171227 agagagcaaaagagcaaagaatttacaacagttgcaatgaaactcgccggaatcaaatcgatagacaacgctcacgacgactccgtttgggcagtcacat 52171128  T
112 gggcaccggcaaccgccacccgaccacctctccttctcaccggctccctcgacgaaacggtacgcctatggaaatccgatgaccttgttctcgaacgcac 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52171127 gggcaccggcaaccgccacccgaccacctctccttctcaccggctccctcgacgaaacggtacgcctatggaaatccgatgaccttgttctcgaacgcac 52171028  T
212 caacaccggccactgtctcggcgtcgcttccgtcgctgctcaccctctcggctcaattgccgcttcttcttctcttgatagctttgttcgtgtctttgat 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52171027 caacaccggccactgtctcggcgtcgcttccgtcgctgctcaccctctcggctcaattgccgcttcttcttctcttgatagctttgttcgtgtctttgat 52170928  T
312 gttgattct 320  Q
    |||||||||    
52170927 gttgattct 52170919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University