View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_77 (Length: 313)
Name: NF0836_high_77
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_high_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 11 - 165
Target Start/End: Complemental strand, 3246102 - 3245948
Alignment:
| Q |
11 |
cagagatagattgtgtatgacgaggatgtactggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3246102 |
cagacatagattgtgtatgacgaggatgtactggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcg |
3246003 |
T |
 |
| Q |
111 |
atctgaacctctttcttgaatccttcttcttctctcttctgtattgttgttgttg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3246002 |
atctgaacctctttcttgaatccttcttcttctctcttctgtattgttgttgttg |
3245948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University