View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0836_high_77 (Length: 313)

Name: NF0836_high_77
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0836_high_77
NF0836_high_77
[»] chr4 (1 HSPs)
chr4 (11-165)||(3245948-3246102)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 11 - 165
Target Start/End: Complemental strand, 3246102 - 3245948
Alignment:
11 cagagatagattgtgtatgacgaggatgtactggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcg 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3246102 cagacatagattgtgtatgacgaggatgtactggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcg 3246003  T
111 atctgaacctctttcttgaatccttcttcttctctcttctgtattgttgttgttg 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3246002 atctgaacctctttcttgaatccttcttcttctctcttctgtattgttgttgttg 3245948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University