View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_80 (Length: 309)
Name: NF0836_high_80
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_high_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 29 - 296
Target Start/End: Original strand, 22734220 - 22734487
Alignment:
Q |
29 |
agaaacttcgaactaaccaccaaactctacttatttgaggcgtgtcggatactaatatggatatatacatctctcggaattcaagtttaggttcaccaca |
128 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22734220 |
agaaacttagaactaaccaccaaactctacttatttgaggcgtgtcggatactaatatggatatatacatctctcggaattcaagtttaggttcaccaca |
22734319 |
T |
 |
Q |
129 |
ttgtgggtagtttagcacattgcattagactcaacctgcactagaatcaacctcgttggtttgacggaagggtctaaacttctacaacatggcgaactaa |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22734320 |
ttgtgggtagtttagcacattgcattagactcaacatgcactagaatcaacctcgttggtttgacggaagggtctaaacttctacaacatggcgaactaa |
22734419 |
T |
 |
Q |
229 |
ggttcaaattccgattgagaaaagtaaccatatttgatgtccggcatgcctccaaatataactacttc |
296 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22734420 |
ggttcaaattccgattgagaaaagtaaccatatttgatgtccggcatgcctccaaatataactacttc |
22734487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University