View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_88 (Length: 279)
Name: NF0836_high_88
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_high_88 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 50 - 150
Target Start/End: Original strand, 22376548 - 22376648
Alignment:
| Q |
50 |
ataaattgatttggtgtatgcaagtgtacggtacacctgcagatttttcacttgcctaccgtggaagacctattaaggtctctcaccctagaaggcgcct |
149 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22376548 |
ataaattgatttggtgtatgcaagtgtacagtacacctgcagatttttcacttgcctaccgtgggagacctattaaggtctctcaccctagaaggcgcct |
22376647 |
T |
 |
| Q |
150 |
t |
150 |
Q |
| |
|
| |
|
|
| T |
22376648 |
t |
22376648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 47 - 150
Target Start/End: Complemental strand, 8710402 - 8710299
Alignment:
| Q |
47 |
aacataaattgatttggtgtatgcaagtgtacggtacacctgcagatttttcacttgcctaccgtggaagacctattaaggtctctcaccctagaaggcg |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
8710402 |
aacataaattgatttggtgtatgcaagtgtacggtacacctgcagatttttcacttgcctatcgtgggagacctattaaggtctctcaccctagaagacg |
8710303 |
T |
 |
| Q |
147 |
cctt |
150 |
Q |
| |
|
|||| |
|
|
| T |
8710302 |
cctt |
8710299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 148
Target Start/End: Complemental strand, 9404182 - 9404149
Alignment:
| Q |
115 |
agacctattaaggtctctcaccctagaaggcgcc |
148 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
9404182 |
agacctattaaggtctcccaccctagaaggcgcc |
9404149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 148
Target Start/End: Complemental strand, 9406343 - 9406310
Alignment:
| Q |
115 |
agacctattaaggtctctcaccctagaaggcgcc |
148 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
9406343 |
agacctattaaggtctcccaccctagaaggcgcc |
9406310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 47 - 144
Target Start/End: Complemental strand, 41734873 - 41734776
Alignment:
| Q |
47 |
aacataaattgatttggtgtatgcaagtgtacggtacacctgcagatttttcacttgcctaccgtggaagacctattaaggtctctcaccctagaagg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
41734873 |
aacataaattgatttggtgtatgcaagtgtacggtacacctgcagatttttcacttgcctaccgtgggagacctattaaggactctcaccctagaagg |
41734776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 149 - 279
Target Start/End: Original strand, 8070288 - 8070418
Alignment:
| Q |
149 |
ttgaaacatatatttatttcgcccatcatgttccctgaacaactactagaagttggnnnnnnnttggcgaagtttttatgatgtggttcggtccggttcg |
248 |
Q |
| |
|
||||||||||||| | ||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8070288 |
ttgaaacatatatgtctttcgcctgtcatgttccctgaacaactactagaagttggaaaaaaattggcgaaggttttatgatgtggttcggtccggttcg |
8070387 |
T |
 |
| Q |
249 |
catataattttatattcaaattaaatgagtt |
279 |
Q |
| |
|
|||||||||| || ||||||||||||||||| |
|
|
| T |
8070388 |
catataatttgatcttcaaattaaatgagtt |
8070418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 149
Target Start/End: Original strand, 28700035 - 28700069
Alignment:
| Q |
115 |
agacctattaaggtctctcaccctagaaggcgcct |
149 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28700035 |
agacctattaaggtctcccaccctagaaggcgcct |
28700069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 117 - 149
Target Start/End: Original strand, 42860676 - 42860708
Alignment:
| Q |
117 |
acctattaaggtctctcaccctagaaggcgcct |
149 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
42860676 |
acctattaaggtctcccaccctagaaggcgcct |
42860708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 150
Target Start/End: Complemental strand, 44122702 - 44122662
Alignment:
| Q |
110 |
gtggaagacctattaaggtctctcaccctagaaggcgcctt |
150 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
44122702 |
gtgggagacctattaagctctcccaccctagaaggcgcctt |
44122662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University