View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_high_91 (Length: 276)
Name: NF0836_high_91
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_high_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 64 - 247
Target Start/End: Original strand, 24518245 - 24518423
Alignment:
| Q |
64 |
attcaaatagtattaggtaggattcgatgaagtttgttatattttgttcctagcatat--atattggcgtgctctatgagtgcgttggtgcacgtcccac |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24518245 |
attcaaatagtattaggtaggattcgatgaagtttgttatattttgttcctagcatatatatattggcgtgctctatgagtgcgttggtgcacgtcccac |
24518344 |
T |
 |
| Q |
162 |
cacacaatatttcaatgtaaagttatatagttttggtatgttttgagtttagaccttcaacatgtcatgtcatttccccttcacgt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24518345 |
cacacaatatttcaatgtaaagttatatagttttggtat-------gtttagaccttcaacatgtcatgtcatttccccttcacgt |
24518423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University