View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_102 (Length: 276)
Name: NF0836_low_102
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_102 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 32162049 - 32161822
Alignment:
Q |
1 |
ccttttcctccacctcttcctcgcatacaatttctcctctcgtggaccccatcaaaactagtgtagtcattgtcat------ggagaatcacttattcaa |
94 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||| | |
|
|
T |
32162049 |
ccttttcctccacctcttccttgcatacaatttctcctctcgtggaccccatcaaaactagtgtagtcattgtcattgtcatggagaatcgctcattcga |
32161950 |
T |
 |
Q |
95 |
ccacgtctttgactagctcaagttaatgtgacattgacgatctcaccaacacatgattaatatttctaagacgaagaatggcgttgaaagattggtgtag |
194 |
Q |
|
|
||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32161949 |
ccacgtctttgggtggctcaagttaatgtgacattgacgatctcaccaacacatgattaatatttctaagacgaagaatggcgttgaaagattggtgtag |
32161850 |
T |
 |
Q |
195 |
gtgtggttggatgggaaagatggatatc |
222 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
32161849 |
gtgtggttggatgggaaagatggatatc |
32161822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 197 times since January 2019
Visitors: 6046