View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_112 (Length: 267)
Name: NF0836_low_112
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_112 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 53123502 - 53123247
Alignment:
| Q |
1 |
caattcaccagcgtataagagaaaaccaaaaccagtgaagaggcaaatacagatggaactaaacttcttggtattatgaaaggtcttcaatattttcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53123502 |
caattcaccagcgtataagagaaaaccaaaaccagtgaagaggcaaatacagatggaactgaacttcttggtattatgaaaggtcttcaatattttcatt |
53123403 |
T |
 |
| Q |
101 |
tcacttgtgtgcctcagattttgcacttatgtcaaaattttgtttcttttcctctttgtgcttttaaannnnnnncactctt--cacagttaccaagaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
53123402 |
tcacttgtgtgcctcagattttgcacttatgtcaaaattttgtttcttttcctctttgtgcttttaaatttttttcactcttcacacagttaccaagaat |
53123303 |
T |
 |
| Q |
199 |
tgcagtgtaagttctcagtctataattgcctttttcgagttttctattcatgcttc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53123302 |
tgcagtgtaagttctcagtctataattgcctttttcgagttttctattcatgcttc |
53123247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 77 - 125
Target Start/End: Complemental strand, 6504730 - 6504682
Alignment:
| Q |
77 |
tgaaaggtcttcaatattttcatttcacttgtgtgcctcagattttgca |
125 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
6504730 |
tgaaaggtcttcaatatcttcattttacttgtgtgcctcagattttgca |
6504682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University