View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0836_low_116 (Length: 266)

Name: NF0836_low_116
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0836_low_116
NF0836_low_116
[»] chr4 (2 HSPs)
chr4 (186-266)||(35934173-35934252)
chr4 (56-110)||(35934289-35934343)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 186 - 266
Target Start/End: Complemental strand, 35934252 - 35934173
Alignment:
186 atcaatcaataattttgtaaatttgaagaatgaaactttaggatattttcccacaaaatttctaaaatggttcggaacaca 266  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||    
35934252 atcaatcaata-ttttgtaaatttgaagaatgaaactttaggatattttcccacaaaatttctagaacggttcggaacaca 35934173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 56 - 110
Target Start/End: Complemental strand, 35934343 - 35934289
Alignment:
56 taaaaacaataaatttagactgcaaaatattagatatacgcaaaatccctgaaca 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
35934343 taaaaacaataaatttagactgcaaaatattagatatacgcaaaatccccgaaca 35934289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 183 times since January 2019
Visitors: 6046